1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
taurus [48]
3 years ago
7

How many miles is the earth away from the sun

Biology
2 answers:
tankabanditka [31]3 years ago
6 0

It is 92.96 million miles from the sun.

romanna [79]3 years ago
3 0
92.96million miles I think
You might be interested in
19. The Ring of Fire has formed a volcanic island chains in the Pacific
kozerog [31]

Answer:The Ring of Fire is a ring of volcanoes around the Pacific Ocean that result from subduction of oceanic plates beneath lighter continental plates. ... This magma rises up through the over-lying plate to erupt at the surface. If the overlying plate is a continent, you get a chain of volcanoes such as the Andes or Cascades.

Explanation:

google hope this helps you

4 0
3 years ago
What do organic fruits and vegetables would be better for your health
julsineya [31]
It will help our bodies to give energy for temporary time.
3 0
3 years ago
I can predict that if female B mouse mate with male b mouse they would be able to produce offspring with curly tail because
trasher [3.6K]

If both parents had a curly tail than most likely the offspring of them would also have the same genes such as a curly tail

3 0
3 years ago
The charge nurse is preparing for the arrival of clients to the emergency department (ed) after a mass casualty incident (mci).
saveliy_v [14]
To determine how many patient can be safely accepted from each level of severity.
5 0
4 years ago
Read 2 more answers
Which human activity has been banned in most areas because of its negative impact on the biosphere?
Ugo [173]
The human activity banned is restaurandts and most public areas is smoking
6 0
3 years ago
Other questions:
  • The human chromosome apparently lacking in gene influence is the: Y chromosome X chromosome chromosome 21
    6·1 answer
  • Which structures are not found in prokaryotic cells
    7·2 answers
  • What’s the Ph and Acid or Base Hydrochloric Acid
    5·1 answer
  • Two species regularly come into contact and form hybrids that have higher fitness than either of the parental species. what are
    11·1 answer
  • Which is an example of mutualism?
    11·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Over one-third of crops are dependent on honey bees to pollinate them. <br> True False
    9·1 answer
  • A man has Huntington's disease (a dominant trait) and a heterozygous genotype. He has four children with a woman who does not ha
    9·1 answer
  • 1.
    7·1 answer
  • Based on multiple types of evidence, the ancestor of all modern humans lived in Africa during the Middle Pleistocene.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!