1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naily [24]
3 years ago
8

Hey i’ll give brainliest please help

Biology
1 answer:
siniylev [52]3 years ago
3 0

Answer:

Explanation:

Oil, coal, natural gas, metals, stone and sand are natural resources. Other natural resources are air, sunlight, soil and water. Animals, birds, fish and plants are natural resources as well. Natural resources are used to make food, fuel and raw materials for the production of goods.

the answer is = A

You might be interested in
What part of a lake is unable to support plant growth
pishuonlain [190]

Answer:

photic zone.

Explanation:

it is a high layer of the water region. There is no land at the top of the water, if we plant the tree there, the shrub will drift into the water. There is Sufficient daylight but there is no ground.

8 0
3 years ago
Bacteria are only found on "dirty" surfaces or objects. *<br> O<br> True<br> O<br> False
storchak [24]

Answer:

False

Explanation:

6 0
3 years ago
Read 2 more answers
After buying a new house by the lake, the Harrison's decided to cut down the trees and bushes that were blocking
madam [21]
Sediment . The trees was blocking the view so its organic
5 0
3 years ago
How could a community increase its food security?
Serggg [28]

Close the yield gap. By 2050, 120 million hectares of natural habitats will be converted to farming in developing countries, the World Wildlife Fund estimates. ...

Use fertilizer more efficiently. ...

Raise low water productivity. ...

Target food for direct consumption. ...

Reduce food waste.

6 0
4 years ago
Read 2 more answers
Anyone know the answer to this biology question?
True [87]

ν=c/λ

c=300.000.000m/s=300.000.000.000.000.000nm/s

λ=532nm

v=300.000.000.000.000.000/532=5.6*10^14Hz(third option)

8 0
3 years ago
Other questions:
  • Number 7 <br> Its about cells
    14·1 answer
  • Which subfield of biological anthropology uses the fossil record to examine the anatomy and behavior of our relatives in the pas
    15·1 answer
  • What is the trait all lipids share?
    6·1 answer
  • Which of the following describes a relationship of predator-prey A. Oxpecker birds eat parasitic ticks off the backs of zebras B
    6·2 answers
  • The primary role of the chromosome is to
    11·1 answer
  • Cells that contain a full set of chromosomes,or pairs of each chromosomes are?
    7·1 answer
  • A difficulty in fossil comparisons is that the fossil may be from: a large plant or animal an old plant or animal an extinct pla
    5·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Why is it important for a pregnant woman to know her Rhesus blood type, and the Rh blood type of the father of her baby?
    8·1 answer
  • Compare and contrast a predator- prey relationship and a parasitic relationship
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!