1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bulgar [2K]
3 years ago
14

Fill in the blank.

Biology
1 answer:
Ilya [14]3 years ago
4 0

Answer:

a mass above sea level is supported below sea level, and there is thus a certain depth at which the total weight per unit area is equal all around the Earth

Explanation:

You might be interested in
What is the name of the DNA sequence to which RNA polymerase attaches to a gene and assists in transcription initiation? What is
daser333 [38]

Answer:

The promoter

Explanation:

The promoter region is the region of DNA sequence which the RNA polymer binds to to initiate transcription. In the archae and eukaryotes, the core portion of the promoter region is called the TATA BOX. The promoter region is also located upstream of the DNA and can about a 100-1000 base pairs long.

6 0
4 years ago
What is Terminator technology
taurus [48]
Terminator technology proposed methods for restricting the use of genetically modified plants by activating some genes only in response to certain stimuli, especially to cause second generation seeds to be infertile

Hope this helps
:)
3 0
3 years ago
Which supports the theory that some mountains were once at the bottom of the ocean?
arlik [135]

Answer:

★ C. fossils of marine organisms are found at the top of some mountains

Explanation:

Hope you have a great day :)

6 0
3 years ago
What is refusal of care and how does it affect the doctor and the patient?
rodikova [14]
When a doctor refuses to care for a certain patient. This can be for numerous reasons, maybe they are not fit to undergo a surgery of some sort, or are being problematic. Either or the doctor nor the patient benefit form this. Doctor misses out on someone to help (i assume that’s the attitude of one working for the greater good) and the patient misses the opportunity to possibly get the help they need.
7 0
3 years ago
50 POINTS AND BRAINLIEST TO WHOEVER IS CORRECT FIRST.How are antiviral drugs used? O A. To treat bacterial infections, such as s
Tpy6a [65]

Answer:

the correct answer is option d

6 0
3 years ago
Read 2 more answers
Other questions:
  • Water "beads up" on synthetic fabric such as polyester but binds to cotton. what is the most likely explanation for this?'
    15·1 answer
  • Describe the symmetry in members of phylum echinodermata?
    11·1 answer
  • At age 4, James underwent a biopsy of the right gastrocnemius muscle. The pathologist's report noted histopathologic changes sug
    12·1 answer
  • I have 2 i just need one more
    6·1 answer
  • How much of the suns engry do mushrooms take!!!!!
    12·1 answer
  • A biologist discovers a new species of animal. It does not have a notochord, but it does have a backbone. Can she classify it as
    13·2 answers
  • What are the basic types of neurons in the spinal cord?
    9·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • What is known as photosynthesis​
    7·1 answer
  • Causes a cell to shrink because of osmosis ?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!