1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sidana [21]
3 years ago
8

(food chains, food webs, and energy pyramid

Biology
1 answer:
const2013 [10]3 years ago
6 0

Answer:

a producer

b rabbit

c it effects the eci system

plant

squiree

snake

hawk

hawk

You might be interested in
The myelin on myelinated neurons can be degraded or destroyed in diseases such as multiple sclerosis-a process called demyelinat
Mazyrski [523]

Answer:

<h2>The speed of action potential propagation get slower down</h2>

Explanation:

Myelination is the process of generating myelin in neurons. In CNS,  oligodendrocyte make the  myelin sheath.

The main function of myelin is to increase the speed of electrical impulses  along the myelinated fiber.

Myelinated fibers lack voltage-gated sodium channels along the myelinated internodes,  having them only at the nodes of Ranvier though which the molecules moves.

Demyelination is the loss of the myelin sheath,  result due to some neurodegenerative autoimmune diseases, resulting in the decrease of the speed of action potential propagation.

6 0
3 years ago
How do unsaturated fatty acids help keep any membrane more fluid at lower temperatures?
Svetradugi [14.3K]
Enable the membrane because that what the guy on the top said
7 0
3 years ago
2. What type of front is represented by the third symbol in the image?
xeze [42]
C. Stationary front

Hope this helped !
8 0
4 years ago
A 34-year-old woman with ulcerative colitis has required long-term treatment with pharmacologic doses of a glucocorticoid agonis
muminat

Answer:

q

Explanation:

4 0
4 years ago
Read 2 more answers
Relate the length of time it takes for light from stars to reach Earth to distances in space.
Sav [38]

Answer:

The time it takes for light from stars to reach us is the distance to the star divided by this speed

Explanation:

light travels at 300,000 kilometers per second or 186,000 per second. The nearest star to us is the sun and it takes about 8.3 minutes for its light to reach us here on Earth

4 0
4 years ago
Other questions:
  • Punnett Square are used to predict the possibility of different outcomes. When looking at one trait at a time it is called a mon
    15·1 answer
  • To aid in the transmission of an impulse,
    8·1 answer
  • When an ethnic group wholly blends with a larger, central culture, it is called
    6·2 answers
  • How meiosis turn one cell into four new sex cells?<br>​
    10·1 answer
  • How is melanocyte cell adapted to its function?
    9·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • In the carbon cycle, carbon from the nonliving environment becomes a
    7·1 answer
  • 2. The_____________
    14·2 answers
  • Please help I will give brainliest
    13·2 answers
  • The navel is on the<br> body surface (in<br> anatomical position).
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!