Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Answer:
Organic and traditional farming are fundamentally different in that conventional farming depends on chemical intervention to combat pests and weeds and provide plant nutrition. Organic farming, on the other hand, produces balanced, abundant food by relying on natural concepts such as biodiversity and composting.
<span>D is the correct answer. According to the 2010 - 2015 list of population growth by the United Nations, Afghanistan is number 21 on the list. This is followed by the Maldives at number 76, then Nepal at number 120, and finally Sri Lanka at number 160.</span>
Answer:
The Turks were introduced to Islam by the MUSLIM ARABS
Explanation:
The Muslim conquest of Transoxiana by the missionaries, sufis and foreign merchants helped convert Turks to Islam.and this was made possible through the infiltration of Persian and central Asian culture.
The first people that introduced the Turks to Islam before the conquest of Transoxiana by the missionaries, sufis and merchants, were the Muslim Arabs. Islam is currently the largest religion in Turkey with 97.8% of Turks identifying as Muslims and this started as far back as the 11th century
Low pressure!
It tends to go from high to low in air pressure! (: If you didn't know - atmospheric pressure can be determined by something called a mercurial barometer! I hope all is well, and you pass! Good luck, rockstar! (:
Let me know if you have any questions, or any comments! (:
