Answer:
either the first one lactic acid fermentation or the third one alcoholic fermentation
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Any herbivores would have thrived if left alive. same with the smaller predators like foxes or owls. populations shoot up. increase in inbreeding if the islands are isolated and eventually disease catches up with them
This is false. There are elements that have three letters, however they don't occur as often as those with one or two letter formulas.
The speed of a chemical reaction when a catalyst is present is that it. A.) It speeds up
