1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
velikii [3]
2 years ago
14

Mitosis creates what types of cells?

Biology
1 answer:
Free_Kalibri [48]2 years ago
7 0
Mitosis and meiosis, two daughter cells whereas meiosis results in 4 sex cells
You might be interested in
When salt is dissolved in fresh water, the density of the water ______ because the mass of the water increases.
Slav-nsk [51]

Answer: b- increases

Explanation:

8 0
3 years ago
Read 2 more answers
The 1964 earthquake in alaska, triggered which other deadly hazard(s)?
Mekhanik [1.2K]
It triggered tsunamis and landslides
6 0
3 years ago
100 POINTS!! ANSWER ALL PLEASE, AND EXPLAIN YOUR RESPONSE!
const2013 [10]

Answer:

I think the height of the ramp affects the distance that the ball can go, but the size doesn't affect it

and as you decrease th height of the ramp it will look like straight thing, when it look like that the ball might need a little force in order to get speed also to go far

but in this condition the size can affect the ball distance it also depends on how much you give to it

Thank you !

8 0
2 years ago
What are some ways cells help an organism?
Burka [1]
Some blood cells responsible for the transportation of oxygen and other are there for rebuilding of tissues. Fights things the body doesn't recognize
5 0
3 years ago
Each horizontal row in a pedigree chart represents a mating. a generation. several siblings. several characteristics.
Pavel [41]

Answer:

Option B, a generation

Explanation:

A pedigree is a tree diagram that represents the relationships between different individuals based on certain facts and medical(genetic evolutionary) histories. Basically , the branches of the tree represents the generations which allows the researcher understand how certain genetic characteristics or traits are transmitted with in a family

Such as transmission of any genetic diseases from one generation to the other.  

Hence, option B is correct

5 0
2 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • The Calvin cycle is considered light-independent because it can occur in darkness. However, most often the Calvin cycle takes pl
    7·1 answer
  • In grafting, the plant with the root system is called the scion rootstock cutting, and the portion of the plant with the buds is
    14·1 answer
  • Biology Milestone/EOC Review
    5·1 answer
  • Which statement is true about white light?
    9·1 answer
  • Enzymes often
    9·1 answer
  • Please!!!!! it’s due today please help me!!!!
    13·1 answer
  • Which of the following types of land is the richest in nutrients and organic material
    15·2 answers
  • In an animal cell, cellular respiration happens in the
    8·2 answers
  • Why is the dominant allele seen in a heterozygous individual
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!