Answer:
hey talking for what-------
Answer:
They are more expensive than potatoes without the vaccine.
The genetically modified crops are produced by using the scientific procedures of genetic engineering. It involves the manipulation of the genome of these crops so as to make them disease resistant, improving the quality of the edible parts and increasing the yield of the plants. The crops are genetically modified with accuracy, precision and implementation of the technology therefore, the crops produced are expensive then the crops produce by the conventional method.
Hence, they are more expensive than potatoes without the vaccine is a disadvantage of the genetically engineered potato plants to produce potatoes that contain edible vaccines.
Explanation:
Well, as asexual reproduction suggets that offspring is genetically identical, you can assume that the "mother cell" qlso has 24 chromosones and thus may potentially have a genetic disorder
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: