1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natta225 [31]
3 years ago
7

Select the correct location on the image.

Biology
2 answers:
White raven [17]3 years ago
8 0

Answer:

196.966.....

Explanation:

This is the atomic mass, you are looking for the combined number of neutrons and protons

I is wrong because that is the atomic number (# of protons)

II is wrong, that is the atomic symbol

III is wrong that is the elements name

DIA [1.3K]3 years ago
4 0

Answer:

the atomic mass would be on the bottom, the atomic number is in the top left

Explanation:

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
How to make punen square
coldgirl [10]
Thats quite easy
the first pair always goes on the left. and the second pair goes on top. its like multiplying witu exponents. but this as an example , look at my first box. one capital L on top and the other on the left you put them together. if its capital and lowercase the capital one always goes first then its the lowercase (Ll). parent genotypes are the the two pair given to you.thr offspring genotype is the percent of the kids in the boxes. hope i helped!(:

3 0
3 years ago
Is grasshopper separation of oxygenated/Deoxygenated blood yes or no
MissTica

no because Separation of oxygenated and deoxygenated blood in the heart of three types of animals. The three-chambered frog heart mixes oxygenated and deoxygenated blood in the ventricle. Therefore, the body never receives fully oxygen-rich blood.

4 0
4 years ago
A plant may open and close its stomata to prevent excess water loss and maintain _____. adaptability homeostasis negative feedba
Harman [31]

The correct answer is the homeostasis.

A plant may close and open its stomata to prevent excess water loss and maintain homeostasis.

Homeostasis is termed as the tendency of organisms to maintain and automatic regulation of their internal environment to be in a stable condition.

We say that the plant is in stable condition when the fluid balance and body temperature are being kept in to a pre-set limits which include calcium ions, potassium, sodium and PH of extracellular fluid.

The natural resistance which changes the optimal condition brings about homeostasis.

8 0
3 years ago
Read 2 more answers
If a population reaches its critical population density, this could happen:
Leona [35]
<span>Population crash is a sudden decrease in the number of people found in a given area as a result of shortage or the lack of environmental resources necessary for reproduction, survival and growth of the population. It is also known as a die back. The answer to your question is A. population crash.</span>
3 0
3 years ago
Read 2 more answers
Other questions:
  • Can you check my work for this worksheet?
    8·1 answer
  • Is the following statement true or false? luminol detects human blood at crime scenes. it changes color if an iron-containing pr
    14·1 answer
  • Does the number of chromosomes correspond to the complexity of an organism?
    10·1 answer
  • To reproduce, female elephants produce eggs and male elephants produce sperm. Offspring are produced by the fusion of an egg wit
    8·2 answers
  • Hair pigmentation in mammals follows the generic enzymatic pathway depicted below. Enzyme A synthesizes a black pigment from a p
    13·1 answer
  • I can be found in animal cells
    14·1 answer
  • Would you describe cells as simple structures? Why or why not?
    10·1 answer
  • The process of evaporation is occurring at which number?
    9·1 answer
  • Types of angiosperms
    13·1 answer
  • What is the term for a three-nucleotide sequence that codes for an amino
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!