1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sever21 [200]
2 years ago
12

Kann mir jemand bei Funktionen helfen​

Geography
2 answers:
hram777 [196]2 years ago
5 0

Answer:

Ja, ich kann dir dabei helfen.

Explanation:

In english, this says" Yes, I can help you with them."

kotegsom [21]2 years ago
3 0

Answer:

huh?

Explanation:

You might be interested in
World geography 5 current events
Solnce55 [7]

by 5 current events, do you mean 5 things going on right now?

4 0
3 years ago
Another name for the National Socialist Party was
barxatty [35]
It can refer to either Nazionale Party or National Socialist German Worker's party. hope this helped
7 0
3 years ago
How can I simplify (3x +y)-(2x+y)?
Drupady [299]
6x^2 + 3xy - 2xy +y^2
6x^2 + xy + y^2   
8 0
3 years ago
Explain what a subduction zone is and how it relates to volcanic activity and earthquakes.​
a_sh-v [17]

Answer:

A subduction zone is a region in which an oceanic tectonic plate slides beneath a continental plate. This action creates volcanic islands and volcanoes along the coasts of continents. It can also generate large earthquakes. If these earthquakes occur offshore in the ocean, they may even generate a tsunami. The oceanic plate also melts during the subduction process, becoming molten rock. This molten material can then push to the surface during volcanic activity.

Explanation:

Plato users! this is the exact answer so you might want to reword it a little

4 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Other questions:
  • Why is it important to study prehistoric earthquakes?
    10·1 answer
  • Which part of Africa is pulling away from the rest of the continent the eastern part, the western part, the northern part, or
    14·1 answer
  • Write a paragraph in response to the question.
    10·2 answers
  • What is the layer of permanently frozen subsoil in the tundra?
    14·2 answers
  • Causes of poor service delivery
    11·1 answer
  • Forests do not _____.
    9·2 answers
  • What is the approximate time of day represented at each location?
    14·1 answer
  • The rate of evaporation depends on four main factors: water body size, heat energy, atmospheric pressure and air movement. Warm
    7·1 answer
  • welp welp welp welp welp welp welp welp welp welp welp welp welp welp welp welp welp welp welp welp welp welp welp welp​
    6·2 answers
  • NEED HELP ASAP !!!!
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!