1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
const2013 [10]
3 years ago
7

What could cause a population to reach it's carrying capacity?

Biology
2 answers:
Lesechka [4]3 years ago
8 0

Answer:

The answer would be "D"

Explanation:

If a population adapts to something that is causing death among them, the death rate will inevitably go down.

Have a blessed day! Please mark brainliest if correct :D

ikadub [295]3 years ago
6 0

Answer:

its d

Explanation:

if a population adapts to a place then people will get use to going there take L.A for example lots of people want to go there now a days so that increases the population capacity in L.A

You might be interested in
What is the role of the enzyme diaphorase
Kruka [31]

The role of the diaphorase enzymes is to transfer hydrogen ions between donor and acceptor molecules.

8 0
2 years ago
Which statement explains how a DNA mutation causes sickle-cell anemia? (point)
gavmur [86]

Answer:

The DNA mutation causes a change in the amino acid sequence for hemoglobin, which causes a change in the shape of red blood cells.

Explanation:

Sickle cell anemia is one of a group of disorders known as sickle cell disease. Sickle cell anemia is an inherited red blood cell disorder in which there aren't enough healthy red blood cells to carry oxygen throughout your body.

Normally, the flexible, round red blood cells move easily through blood vessels. In sickle cell anemia, the red blood are shaped like sickles or crescent moons. These rigid, sticky cells can get stuck in small blood vessels, which can slow or block blood flow and oxygen to parts of the body.

Sickle cell anemia is caused by a mutation in the gene that tells your body to make the iron-rich compound that makes blood red and enables red blood cells to carry oxygen from your lungs throughout your body (hemoglobin). In sickle cell anemia, the abnormal hemoglobin causes red blood cells to become rigid, sticky and misshapen.

The sickle cell mutation reflects a single change in the amino acid building blocks of the oxygen-transport protein, hemoglobin. This protein, which is the component that gives red cells their color, has two subunits. The alpha subunit is normal in people with sickle cell disease. The beta subunit has the amino acid valine at position 6 instead of the glutamic acid that is normally present. The alteration is the basis of all the problems that occur in people with sickle cell disease.

7 0
3 years ago
Is a pansy, hydrangea, and sunflower a monocot or dicot plant?
Alex73 [517]
Pansies and Sunflowers = Dicots
Hydrangeas = Monocots
3 0
3 years ago
Read 2 more answers
Match each branch of science with its related carrier
spayn [35]
D.) = 1.)
A.) = 3.)
C.) = 2.)
B.) = 4.)
6 0
3 years ago
Read 2 more answers
1. Animals that mostly eat other animals fit into the dietary category called __________.
mezya [45]

Answer:

butt

Explanation:

hahahahahaha

5 0
3 years ago
Other questions:
  • Can someone help me with this question??
    9·1 answer
  • Consider the food chain grass → grasshopper → mouse → snake → hawk. How much of the chemical energy fixed by photosynthesis of t
    9·2 answers
  • Which factors involving the activities of people are a threat to biodiversity? pollution and succession habitat loss and predati
    12·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • SF medium is a selective medium, developed in the 1940s, to test for fecal contamination of milk and water. Only certain gram-po
    8·1 answer
  • Which of the following increases the strength of the hydrophobic interactions in lipid bilayers, and thus makes them less permea
    6·1 answer
  • 50 points+brainiest<br> HELP QUICK
    12·1 answer
  • 12. Atoms can have different numbers of which of the following?
    7·1 answer
  • Mendel,s experiment is applicable not only in plant but also in animals​
    6·1 answer
  • A major limitation of using photovoltaic cells to generate electricity is that they.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!