Answer:water diffuses into the phloem from the xylem and sucrose moves to the sink
Explanation:Translocation is the movement of ready produced food substances from the site of production to places in the plant where food is needed. such as the roots.the place where food is produced is called the source, the the place where food is used up is called the sink.the leaves are the source in a plant.photsoynthates, which is the plant manufactired food, may move up and down the stem ,majorly to areas of storage and growth.
Surose is the major intermediate product of photosynthesis.it is the form in which sugar is transported.it is conducted by the phloem vessels.this takes place in the long sieve elements that forms the sieve tubes
The high percentage of sucrose in the phloem sap causes water to pass into it from the xylem. This then causes the sap to move from source to sink.
At the sink, sucrose diffuses out of the phloem.it is either stored up or used for growth and repairs
Cytosine pairs with Guanine
Adenine and Thymine are pairs also
Hope this helps :)
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
