1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ludmilkaskok [199]
3 years ago
13

How does the volume of urine change over time?

Biology
1 answer:
galina1969 [7]3 years ago
6 0

Answer:

An excessive volume of urination for an adult is more than 2.5 liters of urine per day. However, this can vary depending on how much water you drink and what your total body water is. This problem is different from needing to urinate often. hope this helps :)

Explanation:

You might be interested in
Please help whoever’s right I’ll give brainliest
Ann [662]

Answer:

organism

system

tissue

organ

cell

Explanation:

4 0
3 years ago
Read 2 more answers
Mitochondria appear in the greatest numbers in cells that are _____.
brilliants [131]

<u>Answer:</u>

<em>Mitochondria appear in the greatest numbers in cells that are</em><em> </em><em><u>Muscle cell.</u></em>

<u>Explanation:</u>

Mitochondrion is the power house of the cells. It releases the energy need for the cells. So mitochondrion is found in large number in muscle cell because muscles are the component of our body that needs large amount of energy.

Muscles need to be frequently moved in our body so large number of mitochondria helps in providing the enough energy for the proper muscle movement.

7 0
4 years ago
When dissecting you should cut away from yourself?
sineoko [7]

Answer;

-The above statement is true

-It is a precaution during dissecting.

Explanation;

Among the precautions  while dissecting include;

-When cutting into or dissecting the specimen, it is important to always cut away from yourself and others. To avoid cutting anyone, especially with formaldehyde being used. .

-You should also should not hold the animals while cutting because you could again, cut yourself.  Another precaution that should be obvious is Do not eat any part of the specimen.

6 0
4 years ago
Within to the rock cycle, which of the following is NOT correct?
bonufazy [111]

Answer:

Did you get the answer

Explanation:

Pls help

7 0
3 years ago
Read 2 more answers
When DNA is replicated, the original molecule serves as what?
soldier1979 [14.2K]
The old moleule serves as a template.
6 0
3 years ago
Other questions:
  • Why is blood obtained through veins and not from arteries when collecting blood?
    15·1 answer
  • ________ is a condition in which there are bulges in the walls of the colon.
    6·1 answer
  • How do the two species that make up a lichen benefit from their symbiotic association? (Select all that apply.)
    9·1 answer
  • There are 206 bones in the human body in comparison to the bones how many muscles does the human body have
    9·1 answer
  • Why is water extremely cohesive?
    11·1 answer
  • The _________ is the actual genes that an organism has. For example: HH, Hh or hh.
    5·1 answer
  • Is Sustainable development possible? Is sustainable development worth try to achieve? Why?Why not?
    12·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • How could the pressure of a gas increase if temperature is constant?
    7·1 answer
  • What is Cytosine? Where is it located in the DNA? Who is it paired with? What is the role of Cytosine?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!