1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leona [35]
3 years ago
5

When comparing mitochondria and chloroplasts in plant cells, which statement BEST explains a similarity in the cellular function

of these organelles
A
These organelles are both important for the uptake of nutrients from the cell's exterior.
B
These organelles are both important in the regulated transport of molecules within cells.
с
These organelles are both important for the conversion of energy to a usable form for cells.
D These organelles are both important for the use of cellular genetic information to make proteins.
Biology
1 answer:
-Dominant- [34]3 years ago
6 0

Answer:

The correct answer is - с. These organelles are both important for the conversion of energy to a usable form for cells.

Explanation:

Chloroplast and mitochondria are the two organelles that are essential for the biosphere specially autotrophs like plants and heterotrophs as chloroplast is the organelle that converts light energy into chemical energy by forming sugars by the process called photosynthesis by trapping the sunlight.

This chemical energy that is stored in glucose molecule moves to the mitochondria where by the procee of the cellular respiration the chemical energy converted to the ATP, the energy form that is used by the cell for the performing its function.

You might be interested in
Define the verb "adapt". Does survival in a particular environment through coping is synonymous with evolution? Why or why not?
notsponge [240]

Answer:

The word adapt means to get adjusted to a change.

yes, survival in a certain environment is similar to evolution. Both must use adaptation in order for life to keep living through changes in the environment. Each help life sustain itself in a very unique way.

Explanation:

4 0
3 years ago
The bonds that hold atoms together behave most like Select one: a. glue. b. rubber cement. c. flexible springs. d. snap-together
jek_recluse [69]

Answer: Flexible springs

Explanation:

The atoms in an element or compound are bonded together by bonds which keeps the atoms together.

The bonds is stiff but it proves some flexibility for the movement of the atoms so that they can react and form different types of substances.

The bonds between the atoms act like flexible spring which keeps two or more atoms together and flexible for reacting.

3 0
4 years ago
_____ involves creating a small pouch at the base of the esophagus, which severely limits food intake. the stomach may be staple
vampirchik [111]
Bariatric surgery involves creating a small pouch at the esophagus which severely limits food intake. The stomach may be stapled, banded, or bypassed. The most common bariatric surgery procedures are gastric bypass, sleeve gastrectomy, adjustable gastric band, and biliopancreatic diversion with duodenal switch. 
6 0
4 years ago
Glut injection site​
Arturiano [62]

To find the correct location for injecting into the Gluteus maximus muscle, expose the buttocks and divide (in your mind) each buttock into four parts. Aim the injection into the upper quarter of the buttock (X on the diagram), towards the hip bone portion but below the iliac crest which is the bony part of the hip.

8 0
4 years ago
Sex cells or gametes, also known as eggs and sperm, which have half the chromosomes of the organism in them are made during whic
bazaltina [42]
Yes there are cell organisms are divided into each of there own groups
8 0
3 years ago
Read 2 more answers
Other questions:
  • Plants grow taller as a result of which of the following?
    5·1 answer
  • Why was protein originally thought to be the genetic information storage molecule instead of dna?
    6·1 answer
  • What kind of relationship is this
    5·2 answers
  • The letter X in the process represents
    7·2 answers
  • the enzyme catalase will break down hydrogen peroxide into oxygen and water. why doesn't catalase work on protein?please Be spec
    10·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Reputake means that:
    9·1 answer
  • Describe how detrital sedimentary rocks are classified.
    15·1 answer
  • Please give me good luck I have a sciene test and I am not good at science
    9·2 answers
  • How is the function of the mitochondrion important for the role of the ribosome in a eukaryotic cell?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!