1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nekit [7.7K]
2 years ago
13

What is true about all neurons?

Biology
1 answer:
marin [14]2 years ago
8 0

Answer:

im not suuuuureeeeeeeee but i think its a

You might be interested in
Why is it important that cells contain catalase?
Triss [41]
<span>Catalase catalyzes the decomposition of hydrogen peroxide to water and oxygen. It is a very </span>important<span> enzyme in protecting the </span>cell<span> from oxidative damage by reactive oxygen species. Hope this answers the question. Have a nice day.</span>
7 0
3 years ago
List in order the blood vessel and part of the heart
laiz [17]

Answer:

The major blood vessels connected to your heart are the aorta, the superior vena cava, the inferior vena cava, the pulmonary artery (<em>which takes oxygen-poor blood from the heart to the lungs where it is oxygenated),</em> the pulmonary veins (which bring oxygen-rich blood from the lungs to the heart), and the coronary

3 0
3 years ago
HELP ME ASAP
MaRussiya [10]

Answer:

b c and d

Explanation:

they are from different species therefore would not compete for same mates.

4 0
3 years ago
Read 2 more answers
Help if i fail i will not pass
Vinil7 [7]

Answer:

3

Explanation:

I hope this is correct and have a great day

5 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • After a hypothesis has been repeatedly tested and becomes widely accepted, it is considered a?
    7·1 answer
  • In April 2009, a new strain of influenza A emerged. This strain, known as the swine flu, caused at least 95 deaths in over 40 di
    13·2 answers
  • Hey do u guys know what are some good science fair topics
    9·1 answer
  • Match each object to its definition
    11·2 answers
  • How did the convection model show how Earth’s mantle moves Earth’s plates? The water carried the pieces of paper to the middle o
    7·2 answers
  • Pls, help me with this question
    12·2 answers
  • True or False: Matter on Earth is never lost. If an animal or plant dies, the matter in the animal or plant will be used over an
    9·1 answer
  • - How would you classify the relationship between coral and the small crabs?
    13·1 answer
  • If a student starts a pure culture of Geobacter metallire ducens with zero cells, how much cells should they
    12·1 answer
  • During isovolumetric phases of the cardiac cycle, a. The atria are contracting and all heart valves are closed. b. All heart val
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!