Answer:
Then the prey that the fox eats would over populate and it would mess up the whole ecosystem.
Explanation:
Explanation:
A preditor-prey system, the 2 species are related by; co-evolution(because preditors eat prey that is available and plentiful, for example a rodent species.
also, the population cycle because rodents live for a short period of time in the wild, but reproduce quickly. example; spring and summer seasons is when food is most plentiful for all species of wildlife,
true is the correct answer
I want to say the Answer is Polarity Or Hydrogen Bond
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation: