1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tensa zangetsu [6.8K]
3 years ago
7

I need help with all the questions and filling out the punnet square

Biology
1 answer:
Ivanshal [37]3 years ago
6 0

Answer:

Umm are you supposed to be in summer break

Explanation:

Because I am in summer break

You might be interested in
What would happen to an ecosystem if a predator like a fox goes extinct
kow [346]

Answer:

Then the prey that the fox eats would over populate and it would mess up the whole ecosystem.

Explanation:

4 0
3 years ago
In a predator-prey system, the two species are related by: Choose all that apply.
Lemur [1.5K]

Explanation:

A preditor-prey system, the 2 species are related by; co-evolution(because preditors eat prey that is available and plentiful, for example a rodent species.

also, the population cycle because rodents live for a short period of time in the wild, but reproduce quickly. example; spring and summer seasons is when food is most plentiful for all species of wildlife,

3 0
3 years ago
Read 2 more answers
True or False: Cold temperatures could be an example of a stimulus.
AleksAgata [21]

true is the correct answer

4 0
3 years ago
The (weak/strong) attraction of one water molecule to another through those slight charges is called
lyudmila [28]
I want to say the Answer is Polarity Or Hydrogen Bond
7 0
3 years ago
What is the mRNA that would be transcribed from this strand of DNA?
Illusion [34]

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

8 0
2 years ago
Other questions:
  • What is the difference between hydrophobic and hydrophilic molecules
    10·1 answer
  • Carbon dioxide is a ___ of cellular respiration, which occurs in the mitochondria.
    6·1 answer
  • Cross a heterozygous brown, short hair with homozygous brown, hybrid long haired dog
    8·2 answers
  • The changes to the cuttlefish’s skin are related to _______.
    9·1 answer
  • What land plants produce most of the world's oxygen? Please help fast
    10·1 answer
  • Umm I’m confused on this.?
    5·1 answer
  • certain cells have densely packed mitochondria and the cristae ( infolded projections of a mitochondrion) are very closely toget
    10·1 answer
  • Both bony fishes & cartilaginous fishes have ………………..
    5·2 answers
  • The human population Choose one: A. is doubling every 4 years. B. is currently a little over 2 billion. C. reached 1 billion in
    8·1 answer
  • A mathematical model of a food web helps me better understand
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!