1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rasek [7]
3 years ago
11

Match each word or phrase with its definition. Note that not all definitions will be used. - Polygenic traits - Quantitative tra

its - Monozygotic twins - Dizygotic twins - Short tandem repeats - Transcription - Ribonucleic acid - Mutation - Stem cell - Reproductive cloning A. An undifferentiated cell that has not yet been programmed and can become any type of cell B. A subconscious framework C. Traits that are influenced by more than one gene D. A cell that results from in vitro fertilization E. Replacing defective genes with functional genes F. Genetic engineering that exactly duplicates an organism G. Identical twins H. Making mRNA from DNA I. Traits that have a lot of variance in a population J. A change in the DNA sequence K. Fraternal twins L. Thirteen DNA sequences that all humans carry M. Traits that involve the actions of many genes but also interact with the environment N. Uses ribose as the sugar in the nucleotide
Biology
1 answer:
shepuryov [24]3 years ago
8 0

Answer:

A. An undifferentiated cell that has not yet been programmed and can become any type of cell = Stem cell

C. Traits that are influenced by more than one gene = Polygenic traits  

F. Genetic engineering that exactly duplicates an organism = Reproductive cloning    

G. Identical twins = Monozygotic twins  

H. Making mRNA from DNA = Transcription

J. A change in the DNA sequence = Mutation  

K. Fraternal twins = Dizygotic twins  

L. Thirteen DNA sequences that all humans carry = Short tandem repeats  

M. Traits that involve the actions of many genes but also interact with the environment = Quantitative traits

N. Uses ribose as the sugar in the nucleotide = Ribonucleic acid

Explanation:

Stem cells are undifferentiated cells that are capable of self-renewal or differentiation into many different types of cells. Polygenic traits are phenotypic traits influenced by two or more genes, while quantitative traits are phenotypic features controlled by the combined effects of many genes and environmental factors. Reproductive cloning is a laboratory technique used to produce genetically identical individuals from mature somatic cells. Monozygotic twins are identical twins obtained by fertilization of a single egg cell which then splits in two, while dizygotic twins are generated by fertilization of two different eggs. Transcription is the process where the genetic information contained in a strand of DNA is copied into a particular type of RNA (mRNA, tRNA, ncRNA, etc). A mutation is a genetic alteration in the DNA sequence of a cell of a living organism that is produced during DNA replication. Short tandem repeats (STRs) are repeated DNA sequences (2-16 nucleotides, two or more times) that are adjacent to each other. In humans, there are 13 well-characterized STR sequences known to be associated with populations of different ethnic groups.

You might be interested in
In an ecosystem, which is not a density-dependent limiting factor?
sertanlavr [38]
<span>D. Natural Disaster </span>
8 0
3 years ago
Read 2 more answers
Bird species from temperate regions must cope with relatively short breeding seasons. A study examined the relationship between
lara31 [8.8K]

Answer:

The answer is "-0.4".

Explanation:

In that situation, the value of the possible correlations between the egg-laying logarithm as well as the testosterone level logarithm is equal to 4 It value is equal to the percentage 4=-0.4.

7 0
3 years ago
"the tertiary structure of the human enzyme called lysozyme is stabilized by ionic bonds between the r-groups (side chains) of a
USPshnik [31]

The tertiary structure of the proteins  is a three-dimensional structure. The polypeptides are arranged in a three-dimensional structure, which primarily arises because of the interaction between the side chains (R group) of the amino acids making up the protein.

The aspartic acid is a charged protein which is capable of forming the salt bridges. It can form ionic bonds with the R group of the other proteins. Hence, it can form ionic bond with the side chain of  the amino acid lysine.

Hence, the answer is aspartic acid.

7 0
3 years ago
The Forensic Anthropology Facility is located in which US state?
xenn [34]

<span>Knoxville, Tennessee, <span>United States</span></span>
6 0
3 years ago
What will happen to you if you were cutoff from your peripheral nervous system
schepotkina [342]

Answer:

Symptoms of PNS damage include problems with sexual function, bladder control, blood pressure regulation, digestion and loss of sensation in the hands and feet. ... The cells can revert back to an immature 'repair' cell due to their plasticity, therefore allowing them to repair damage to the PNS.

6 0
4 years ago
Other questions:
  • When an object is burning, two atoms of oxygen (in the air) combine with one atom of carbon (from the
    9·1 answer
  • You are conducting an experiment to test the hypothesis that apple trees will produce larger fruit when exposed to music. You ha
    10·1 answer
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • The Moon's phase is waning when it changes from
    14·1 answer
  • Help please!
    9·1 answer
  • What would be an adoption in a rain forest but not in a tundra
    10·1 answer
  • What is the atmospheric pressure?
    9·1 answer
  • Developing a fever of 103 degrees F, a headache, and complaining of abdominal pain. As you examine her throat, you see that in a
    7·1 answer
  • Which of the following best describes how scientists
    11·1 answer
  • Gametes are ______ They have ______ the number of chromosomes.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!