2 years ago

Why do plants need water, and how does this affect food chains and food webs

1 answer:

7 0

Plants need water to survive! They go through a process called photosynthesis where water and CO2 is converted to food. This is jmportant for the food chain because other animals eat the plants to survive as well!! Hope this helped.

You might be interested in

If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix

Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0

2 years ago

Can a WILD panther eat a COOKED egg

Irina18 [472]

Not sure i’m pretty sure no

7 0

2 years ago

Read 2 more answers

1. How do cells relate to your genes and how can cells differentiate into the specific body parts?

11111nata11111 [884]

Cells relate to your genes via genetic code. The genetic code is also what tells the cells what type of cell to become (brain cell, stomach cell, etc.)

7 0

3 years ago

In Labrador retrievers some puppies have pink noses and some have black. Labrador retrievers with black fur almost always have b

rewona [7]

This is the gene cycle and if their mother has different gene then that will happen.

3 0

2 years ago

What soil develops on top of there parent bedrock?

maw [93]

Answer:

I think it's top soil.

6 0

2 years ago