1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kumpel [21]
3 years ago
13

How is it possible for a baby to show traits that neither parent showed?

Biology
2 answers:
eimsori [14]3 years ago
4 0
It is possible that the baby got its traits from it grand parents which are the mom and dads parents and it could get them from a family member 10 generations ago
Evgesh-ka [11]3 years ago
3 0
The baby had to of gotten both of the recessive genes from its parents
 
You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Early cells likely formed from a group of organic compounds, including proteins, and primitive fatty acids. Why do most scientis
nordsb [41]
The reason why nost scientists thought  that the first true cells formed on Earth were anaerobic is being shown in the second option :B. because there was no oxygen on early Earth. Paying attention to this fact scientists discovered that first cells were prokaryotes and greatest part of them created oxygen as a toxic by-product of their own metabolism which make them understand how the planet was provided with oxygen and made a conclusion that first cells were anaerobic.
4 0
3 years ago
What is the most common health problem associated with consumption of too much sodium?
stellarik [79]
The most common health problem associated with consumption of too much sodium increases blood pressure which can lead to heart disease. Other problems that result from too much salt intake are high cholesterol and heart attacks.  
5 0
3 years ago
How do amino acid sequences influence the properties of a protein?
Katarina [22]
<span>The amino acid sequence contains the necessary information </span>to<span> determine how that particular </span>protein will<span> fold into a 3-dimensional structure as well as the stability of the resulting structure.</span>
3 0
3 years ago
Will give brainliest to people that help me with these questions
andrezito [222]

Answer:

b

Explanation:

vgvgjvjvjhvhbkhbkkjb

7 0
3 years ago
Other questions:
  • How is science different from thought?
    12·1 answer
  • A cycad has
    12·1 answer
  • which structure in plants produce a substance that protects the extending roots from developing friction?
    15·2 answers
  • Agile methods in science engineering take which of the following approaches towards creating solutions?
    8·1 answer
  • I NEED HELP
    13·1 answer
  • PLEASE HELP!!!!!!<br><br>how is bacterial and human DNA related? ​
    6·1 answer
  • _How do bacteria reproduce?
    5·2 answers
  • The order of the genes on a plant chromosome is A, B, C, where A and B are located 10 cM apart and B and C are located 3 cM apar
    9·1 answer
  • What do plants make through the process of photosynthesis
    15·2 answers
  • What process adds carbon dioxide to the air?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!