1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oliga [24]
3 years ago
11

Describe the similarities and differences between the features found in prokaryotic and eukaryotic plant and animal cells

Biology
1 answer:
Sloan [31]3 years ago
8 0
Plant cells have a cell wall, animal cells don't.
Plant cells have a large central vacuole and animal cells have more numerous, smaller vacuoles.
Plant cells have chloroplasts and animal cells do not.
Hope this helps ;)
You might be interested in
What is a consequence of the specific heat capacity for liquid water, ice and water vapor
Arisa [49]

<em>Water has unique chemical characteristics in all three states—solid, liquid, and gas—thanks to the ability of its molecules to hydrogen bond with one another. Since living things, from human beings to bacteria, have a high water content, understanding the unique chemical features of water in its three states is key to biology. </em>

<em>In liquid water, hydrogen bonds are constantly being formed and broken as the water molecules slide past each other. The breaking of these bonds is caused by the energy of motion (kinetic energy) of the water molecules due to the heat contained in the system. </em>

<em>When the heat is raised (for instance, as water is boiled), the higher kinetic energy of the water molecules causes the hydrogen bonds to break completely and allows water molecules to escape into the air as gas. We observe this gas as water vapor or steam. </em>

<em>On the other hand, when the temperature drops and water freezes, water molecules form a crystal structure maintained by hydrogen bonding (as there is too little heat energy left to break the hydrogen bonds). This structure makes ice less dense than liquid water.</em>

8 0
3 years ago
The first scientist to study plankton was:
Nutka1998 [239]

The answer is

Victor Hanson

7 0
3 years ago
Read 2 more answers
Which of the following contains stem cells that can produce only their own type of cells
allsm [11]
The following contains stem cells that can produce only their own type of cells is the answer B adult
7 0
3 years ago
How is the mass number calculated for an element
Lostsunrise [7]
<span>The atomic number of a neutral atom is equal to the number of protons and the number of electrons of the atom. The atomic weight meanwhile is equal to the sum of the number of protons and number of neutrons. We add therefore the number of protons and number of neutrons </span>
4 0
3 years ago
What percentage of the Earth’s rain forests have been lost to deforestation since 1950?
White raven [17]
As a matter of fact it is 40%.
4 0
3 years ago
Read 2 more answers
Other questions:
  • How many Angstroms are in a meter?
    13·2 answers
  • A 22-year-old female comes to your office with complaints of right lower quadrant abdominal pain, which has been worsening over
    8·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A _____ is the smallest particle of a substance that has all the properties of the substance.
    15·2 answers
  • Why can carbon from very large molecules?​
    8·1 answer
  • An objects ... forming car center of the universe but its ... can change from planet to planet if you increase the mass of a pla
    7·1 answer
  • What causes convection cells to occur in the atmosphere?
    9·1 answer
  • What do the results suggest about ways that milkweed bug populations are limited in nature?
    8·1 answer
  • 1.) A swollen guard cell is called<br><br> 2.) A flat guard cell is called
    8·1 answer
  • g What is the first step of the scientific method? a. Observe a phenomenon. b. Design and conduct an experiment. c. Formulate a
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!