1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erastovalidia [21]
3 years ago
14

ANSWER FAST PLS!

Biology
1 answer:
sergey [27]3 years ago
4 0

Answer:

i think it's bacteriophage

You might be interested in
Going long does carbon dioxide last
Mademuasel [1]

Answer:

carbondioxide last in about 300 to a 1000 years in the atmosphere

6 0
2 years ago
During exercise, the blood is travelling more quickly around the body. This carries more oxygen to the exercise muscles. Describ
MA_775_DIABLO [31]

Answer:

your heart rate goes up explaining why the blood is traveling quicker. this causes you to breath faster meaning bring more oxygen to the blood in your lungs faster. your blood pressure also goes up from the increase in heart rate.

6 0
3 years ago
Read 2 more answers
A newly discovered solar system is found 300 billion kilometers from the sun. How many AU does this represent? Show your work.
Aleksandr-060686 [28]

1 kilometer = 6.68 × 10^{-9} (<<<AU is in scientific notation here)

To convert 300 billion kilometer (3,000,000,000 km)  into AU you must multiply the kilometer by the equivalent of 1 km in AU (6.68 × 10^{-9})

3,000,000,000 × (6.68 × 10^{-9}) =  20.04 AU

Hope this helped!

4 0
3 years ago
When a racher puts cattle in a pasture, what happens to the amount of grass in it?​
fgiga [73]

Answer: Cows put in a pasture of fresh grass will eat it down too a point it would regrow fast.. Unless the pasture is not large enough for the number of cattle. Then they will eat it into the ground and kill it.

Explanation:

8 0
3 years ago
Which statement is true about flood risk in the United States? Floods happen every few years and are usually only mild. Floods h
Luba_88 [7]
<span>Floods are the country's number one natural disaster.</span>
5 0
3 years ago
Other questions:
  • What method do bacteria reproduce? What is it called?
    10·1 answer
  • Why does compact bone have canaliculi, but spongy bone does not?
    8·1 answer
  • Comparing organisms' DNA can show?
    15·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Black bears live is many different habitats. What is one abiotic feature of the black bears habitat, no matter where it lives?
    12·2 answers
  • DNA and RNA are which types of macromolecule?
    15·2 answers
  • Directions
    5·1 answer
  • The two stages which make up the process of photosynthesis
    7·1 answer
  • Antibodies are
    8·1 answer
  • What happens to ADP after ATP hydrolysis?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!