Difference between pleomorphic and dedifferentiated

1 answer:

5 0

Pleomorphism (microbiology): the ability of some bacteria to alter their shape or size in response to environmental conditions. Dedifferentiated liposarcoma is the least common subtype of liposarcoma and usually arises from a well-differentiated liposarcoma (WDLPS). Progression occurs. in 17 % of patients when WDLPS is located in the retroperitoneum and 6% of cases when WDLPS is located in the extremities.

You might be interested in

The amount of sun energy reaching Earth that reflects back into space is about one

Veseljchak [2.6K]

The answer is c. last time i had that and my teacher said it was c

4 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

The formation of the fertilization envelope (slow-block to polyspermy) requires an increase in the availability of _____.

jok3333 [9.3K]

<span>The formation of the fertilization envelope (slow-block to polyspermy) requires an increase in the availability of </span>calcium ions.

Slow-block to polyspermy is also called cortical reaction. In this reaction, the sperm will be permanently blocked by cortical granules. The release of calcium ion will trigger this reaction.

7 0

3 years ago

Why do Plants cells have cell walls and Animal cells do not?

zimovet [89]

Answer:

Plants need a rigid structure. Animal cells have flexible cell membranes. So animal cells can have a variety of shapes, but plant cells can not, they have to take the shape of their cell walls. Both plant and animal cells are eukaryotic, so they contain membrane-bound organelles like the nucleus and mitochondria.

4 0

2 years ago

Read 2 more answers

What purpose does a female pine cone serve

Alinara [238K]

It protects the seed until it matures!

6 0

3 years ago

Read 2 more answers