1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fynjy0 [20]
2 years ago
8

Which direction do new york state weather systems usually approach from

Biology
1 answer:
Rudiy272 years ago
4 0

Answer:

west to east

Explanation:

The weather system of New York moves in the west to east direction. It is driven by the jet stream which moves from west to east.

The jet stream is nothing but the normal trade winds  that blows in and around the equator and move from west to east. While very strong wind forces start blowing from east to west due to the tropical trade winds

You might be interested in
If this is on the gene in the DNA, how would the mRNA copy of it read? AATGCTCAG
mario62 [17]

Answer:

The answer would be A.

Explanation:

In mRNA sequence, the base T will be replace by base U. So in this case, DNA sequence is AATGCTCAG, then mRNA sequence is AA<u>U</u>GC<u>U</u>CAG.

3 0
3 years ago
Read 2 more answers
Which of the following is a nonrenewable resource?
Setler [38]
All of the above because fossil fuels are non renewable and all of these are fossil fuels
3 0
2 years ago
Read 2 more answers
Identify two ways in which you
Mars2501 [29]
Idk what this means sorry
6 0
3 years ago
Read 2 more answers
Under what conditions can carrying capacity for a population reach equilibrium
dedylja [7]

Answer:When food, water, and space used by a population stay stable over time.

Explanation:

7 0
2 years ago
Single maploid cell (with genetic normation from only one parend surrounded<br> hard outer wall
Misha Larkins [42]

Answer:  spore a single haploid cell (with genetic information from only one parent surrounded by a hard, outer wall.

Explanation:

3 0
3 years ago
Other questions:
  • 1. How is pressure related to force and surface area?
    13·1 answer
  • A force that causes an object to change its motion is called?
    6·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • The illustration shows an ocean food chain and the concentrations of the toxin DDT at each trophic level. What conclusions can b
    8·1 answer
  • You perform an in situ hybridization on Drosophila melanogaster embryos. You apply a probe labeled with a fluorescent stain that
    15·1 answer
  • Unequal distribution of ions across a cell membrane is called what?
    10·1 answer
  • The image below shows a weather service map. A weather service map. Lines are connecting points of equal air pressure. Lines are
    7·2 answers
  • List the features that are common to all cells​
    5·1 answer
  • The document in which elements are organized by their properties<br> is known as the
    8·1 answer
  • A dam is built in a remote area to provide electricity to nearby towns.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!