1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alexxx [7]
3 years ago
9

Mitochondria and chloroplasts are thought to have originated as prokaryotic endosymbionts, True or false?

Biology
2 answers:
nasty-shy [4]3 years ago
7 0
It is true. If you look at a book about this, it should say. Hope this helps!
sergiy2304 [10]3 years ago
3 0
I think this is false, but I’m not 100% sure.
You might be interested in
Osmosis is the diffusion of small molecules. -------------------------------------------------------------------------------- Tr
hichkok12 [17]
The answer to your question is false cause…<span>Diffusion and osmosis are related concepts, which involve movement of materials from areas of high concentration to areas of low concentration. Diffusion involves movement of any chemical from one place to another; osmosis refers to movement of water across a membrane. Only water can undergo osmosis.</span>
7 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
florida panthers have had to adapt to a changing environment. how did this almost cause the extinction of the species?
dusya [7]
They had to change they way they live which is quite difficult it is like you going to a new school in a new state and not being used to anyone
5 0
2 years ago
Question 1 (2 points)
ch4aika [34]

Answer:genetic drift

Explanation:

3 0
3 years ago
Roots spread<br> out under grounds<br> like the branches<br> of a tree why?
Mrac [35]

Answer:

roots spread out underground like the branches of a tree as to get sufficient water and nutrients form the soil to transport to the other parts of the tree for its own growth , by spreading out roots tend to collect or suck the maximum nutrients

7 0
3 years ago
Other questions:
  • How does a single change in nitrogen base alter the formation of a protein
    7·1 answer
  • Differences between the process of aerobic respiration and fermentation
    11·1 answer
  • In a diploid invertebrate, genes d and e are closely linked. single crossovers between these two genes occur only in one out of
    8·1 answer
  • Clinical indications for the use of adrenergic drugs stem mainly from their effects on the heart, blood vessels, and bronchi. Th
    9·1 answer
  • What is the genotype of a women who is a carrier heterozygous for color blindness
    15·1 answer
  • What is the anatomy of a leaf
    6·1 answer
  • An increase in body fluids leads to an increase in kidney filtration which leads to an increase in kidney output (urine). What t
    15·1 answer
  • What was the invasive species on Christmas Island that changed the ecosystem?
    7·2 answers
  • Which of the following correctly summarizes the process of photosynthesis? B.2.4 *
    15·1 answer
  • Briefly summarize the structure of moss.
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!