All categories

3 years ago

What is considered the first stage of the cell cycle?

Biology

1 answer:

kirill115 [55]3 years ago

7 0

Answer:

The first stage is the Interface.

Explanation:

There are primarily two main stages in a cell cycle; but the first stage is the interface. This is a stage in which a cell grows and also replicates its DNA.

It can be said to be the longest phase of the cell cycle. During this phase the cell growth reaches its maximum size, replicates its DNA, prepares for cell division, and also performs it very cellular functions.

This stage has three parts which include: G1, G2 and S phases.

Some cells do not need to divide to exit the cell cycle. These cells can exit the cell cycle permanently. Example is a neurons, they may also exit the cell cycle temporarily. These cells are said to be in G0 which is not a stage of the cell cycle.

You might be interested in

3. What happens to the energy that is consumed by any level in an energy pyramid?

beks73 [17]

Answer:

The amount of energy at each trophic level decreases as it moves through an ecosystem. As little as 10 percent of the energy at any trophic level is transferred to the next level; the rest is lost largely through metabolic processes as heat.

Explanation:

4 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

2 years ago

How much natural gas is used in the United States each year? How does this compare with oil and coal use?

kap26 [50]

Answer:In 2019, the United States consumed about 31.01 trillion cubic feet (Tcf) of natural gas.

Explanation:

3 0

2 years ago

Pulmonary arteries transport ________.

andrezito [222]

Answer:

Explanation:

I would say this because the pulmonary circulation only transports deoxygenated blood. And this blood gets transported to the lungs so the lungs can absorb oxygen and release carbon dioxide. I am not sure about this one though. This is what I think.

3 0

2 years ago

PLEASE HELP!

PIT_PIT [208]

Answer:

All the ones listed below are true

6 0

1 year ago