1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vagabundo [1.1K]
3 years ago
9

Name the 2 types of muscle

Biology
2 answers:
motikmotik3 years ago
6 0

Answer:

The two types of skeletal muscle fibers are slow-twitch (type I) and fast-twitch (type II). Slow-twitch muscle fibers support long distance endurance activities like marathon running, while fast-twitch muscle fibers support quick, powerful movements such as sprinting or weightlifting.

Explanation:

hope this helps     :)

wel3 years ago
6 0

*fast-twitch muscle

*slow-twitch muscle

*skeletal muscle

(I know you said 2 so I’m sorry for doing 3 but yeah-)

You might be interested in
How are meiosis and mitosis different
djverab [1.8K]
I think it is D........
3 0
3 years ago
Read 2 more answers
Why is it beneficial to use textiles made from synthetic fibers
mestny [16]
Synthetic fabrics<span> are </span>textiles made<span> from man-</span>made fibers<span> rather than natural </span>fibers. Chemically produced fabrics<span> are </span>made<span> by joining monomers into polymers, through a process called polymerization. A </span>synthetic fabric<span>, when magnified, looks like plastic spun together.</span><span>

Natural fabrics, such as cotton, silk, and wool, are made from animals or plant based fibers. While synthetic are man made and produced entirely from chemicals to create fabrics. such as polyester, rayon, acrylic, and more. The benefits of using textiles made from synthetic fibers is that it saves the animals and plants that the fibers are based off of. 

Hope this helped :)

</span>
5 0
4 years ago
True or false scientists are certain that human beings cause global warming and climate change​
kiruha [24]

Answer:

yes not just scientists but everyone! all the wars and battles thats happening and pollution and lack of nature are all causing global warming and climate change.

so ur answer is true!

~batmans wife dun dun dun....

7 0
3 years ago
If "quercus" is the genus name and "rubrus" is the species name for a red oak tree, which is the most correct written form of th
Oliga [24]
Quercus rubrus would be the scientific name
6 0
3 years ago
HELPP FAST 20 POINTS AND BRAINLIEST ANSWER i need 2 answers tho
zhuklara [117]
I only have an answer for number 24, I'm sorry! But one piece of evidence is the DNA sequences, they have discovered that humans and monkeys/apes share a common ancestor through DNA. Another would be fossils, scientists have fossils to show great similarities in the skull and jaw structure, along with the legs, comparing to humans.
6 0
3 years ago
Other questions:
  • A population contains short plants and tall plants. The short plants are not able to conpete with tall plants for sunlight. The
    11·1 answer
  • A parking lot paved with asphalt is abandoned describe the parking lot 5 years after it's abandoned
    8·1 answer
  • What is happening to the cell in diagram B?
    12·1 answer
  • Can you use any card at a store
    14·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Identify two major functions of dna pol 3 in dna replication
    8·1 answer
  • Why are regions where convection currents diverge more suitable for building geothermal power stations? A. Divergent boundaries
    15·2 answers
  • How would you describe the relationship between the mass of a car and its kinetic energy?
    5·2 answers
  • Small hydrophilic molecules are transported through a cell membrane by
    5·1 answer
  • From where does a heterotroph directly obtain its energy?.
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!