1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tankabanditka [31]
3 years ago
11

Why is hand washing so important and when should hands be washed?

Biology
1 answer:
natta225 [31]3 years ago
7 0
Hand washing is of importance for its hygenic and cleanliness is important and reduces bacteria and potential viruses and its best if The average human washes their hands if they engage in activities that are messy or not hygenic and its common and necessary that washing ur hands is something we humans do a lot of. Hope this helped.
You might be interested in
The fact that fish, penguins, and dolphins all have the same basic shape is BEST explained by which of the following?
NISA [10]

Answer:

I would say it is E.

Explanation:

because fish, penguins, and dolphins are aquatic animals. It can't be A. because if it were vestigial it would be useless. It can't be B even though it does seem like the right answer because the are all aquatic. It can't be C. because it would been that the same species would have the same niche which is not possible. It can't be D. because every organism is evolved from a common ancestor.

6 0
3 years ago
Read 2 more answers
Being interested in native butterflies, you include the native caterpillar host plants of several butterflies in your annual lan
svetoff [14.1K]

Answer:

d. introduce native flowering plants the adult butterflies need for nectar, their main food.

Explanation:

Organisms choose the habitat based on the availability of basic requirements such as food, nutrients, space, etc. in the region. The absence of one or more of these factors makes them choose another habitat. Butterflies feed on nectar made by plants in their flowers. To make the butterflies stay in the landscape, flowering plants adapted to local conditions should be planted. The butterflies would feed on the nectar of these plants and would stay in the landscape.

3 0
3 years ago
HELP PLEASE!
Andrei [34K]
The answer is A.) Troposphere, Stratosphere, Mesosphere, Thermosphere
6 0
3 years ago
Read 2 more answers
The hormone cortisol is released by the adrenal gland as a response to physical or psychological stress. It can __________ the h
Inga [223]

Answer:

all increase as cortisol is adaptive hormone

7 0
3 years ago
Read 2 more answers
Which is an abiotic factor that affects a freshwater ecosystem?
yaroslaw [1]
<span>C.The amount of light </span>
6 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is NOT a
    11·2 answers
  • What are some adaptations that makes a frog a amphibian
    12·2 answers
  • Is alcohol addiction biologically determined or culturally influenced?
    15·1 answer
  • How do scientists use recombinant DNA technology to produce the drug insulin?
    14·1 answer
  • In the 1930s, how did Dobzhansky and Mayr explain the origin of species?
    13·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • All parts of the cell are made of ______________ ?
    13·1 answer
  • Which of the following question must be asked about the use of resources in an economic system
    7·1 answer
  • What is an anticodon?
    8·1 answer
  • Breathing into and out of a paper bag for a long period of time will lead to?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!