1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pentagon [3]
3 years ago
12

How DNA codes for different PROTEINS that make up your body.

Biology
2 answers:
S_A_V [24]3 years ago
5 0

Answer:

RNA

Explanation:

Aleonysh [2.5K]3 years ago
4 0

Answer:Each length of DNA that codes for a specific protein is called a gene. For instance, one gene codes for the protein insulin, the hormone that helps control levels of sugar in the blood. Humans have around 20,000–30,000 genes, although estimates vary.

Explanation:

The DNA sequence that houses the information to make a protein is called a gene. Each group of three bases corresponds to specific amino acids, which are the building blocks of proteins. For example, the base pairs T-G-G specify the amino acid tryptophan while the base pairs G-G-C specify the amino acid glycine.

You might be interested in
What are the answers to these 3 questions?
Yuliya22 [10]

Answer:

1. A, 2. C, 3. B

Explanation:

number 1 is A, number 2 is C, number 3 is B

3 0
3 years ago
Why are fossil fuels considered nonrenewable resources if they are still forming?
Leni [432]

Answer:

a

Explanation:

Fossil fuels are considered non renewable because they take millions of years to form but depleted faster than they are formed.

6 0
3 years ago
3. Fill in the table below by writing the strand of mRNA that would be formed by each strand of DNA. Hint:
Brrunno [24]

Answer:

1. TTCAT

2.GCSTC

3.TTCAT

4. GCATC

8 0
3 years ago
Which taxonomic category is made up of several classes?
melomori [17]

The scheme of modern taxonomy goes:

Life > Domain > Kingdom > Phylum > Class > Order > Family > Genus > Species

So, a PHYLUM is made of several classes.

3 0
3 years ago
Read 2 more answers
Why did Gregor Mendel use peas in his experiment?
Yuki888 [10]

4. Peas gave characteristics that have two forms

4 0
2 years ago
Read 2 more answers
Other questions:
  • Explain where the pericardium is found and what it does for the heart?
    10·1 answer
  • You are walking to school when you encounter a strange barking dog. you tense up and contemplate whether you should run away. wh
    10·2 answers
  • Which of the following occurs in the upper respiratory system?
    15·1 answer
  • This is a period of time when extensive glacial ice covered much of earth, producing long-term climate change and causing the ex
    6·2 answers
  • What is the role of the serous membranes covering some organs?
    13·1 answer
  • Which of the following best explains how genetic recombination influences evolution?
    15·1 answer
  • Human hair color is a classic, if oversimplified, example of recessive epistasis. Red hair is caused by a recessive allele r. Ho
    6·1 answer
  • Solomon is studying for class. To remember the term _____, he uses the analogy of a thermostat in a house. For instance, when th
    14·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Formas de contaminación terrestre y acuática
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!