1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fomenos
3 years ago
6

Laaaast question :) heeeeeeeeeeelp plz

Biology
1 answer:
wel3 years ago
5 0

Answer:

Explanation:e

You might be interested in
PLEASEE HELPPPPPPPPPPPPPPPPPPPPPP!!!!!!!!!!!!!!!!!
Hatshy [7]
I think the answer is A
8 0
4 years ago
Read 2 more answers
How does the process of mitosis differ between most eukaryotes and other eukaryotes such as diatoms and dinoflagellates?.
Minchanka [31]

Answer:

In most eukaryotes, the nuclear envelope fragments, but in diatoms and dinoflagellates, it remains intact.

Explanation:

3 0
2 years ago
Salinity of ocean water is only determined by the temperature of the water.<br><br> true<br> false
lesantik [10]
FALSE.................

7 0
3 years ago
Read 2 more answers
Which of these glands produce a hormone that maintains the balance of calcium and phosphorus in the blood?.
anyanavicka [17]

Answer:

It is called Parathyroid hormone

Parathyroid hormone, also called parathormone or parathyrin, is a peptide hormone secreted by the parathyroid glands that regulates the serum calcium concentration through its effects on bone, kidney, and intestine.

8 0
3 years ago
Read 2 more answers
Which organism has the least differences in the number of amino acids in cytochrome c compared to
Evgesh-ka [11]

Answer:

Using the number of amino acid differences, it would appear that the two birds are more closely related (had a common ancestor very recently), while the two fungi would have to trace their common ancestry much farther back in time (much more distantly related).

5 0
3 years ago
Other questions:
  • Which of these must occur during S phase of the cell cycle so that two daughter cells can be produced during M phase?
    15·1 answer
  • Biochemistry is the study of _____.
    15·2 answers
  • What is the complement for the following segment of DNA - AGCTAGGACTTA
    5·1 answer
  • "What kind of map are we looking at and what do the shadows and colors represent?"
    14·1 answer
  • Vitamin d _____.
    11·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • If a God created the Universe, then who created God?
    14·1 answer
  • I don’t know these questions
    10·1 answer
  • Play‘s the steps for the formation of enzyme pepsin the pepisnogen in the correct order
    10·1 answer
  • Figure 12-1 shows the structure of an
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!