1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yan [13]
3 years ago
14

1. DNA base sequence: GACGATGTAGCATCGACCATTG.

Biology
1 answer:
prisoha [69]3 years ago
3 0
CUGCUACAUCGUAGCUGGUAAC
You might be interested in
According to the Hardy-Weinberg principle, which of the following is most likely to disrupt genetic equilibrium
Alona [7]
Answer - There can be many factors such as mutations, natural selection, nonrandom mating, genetic drift, gene flow. But nonrandom mating can have long term effects.

Reason - Reason why it has a long term effect is because of the survival of that organisms and how it will adapt to its own environment with the introduction of nonrandom mating etc..

5 0
3 years ago
Humans are about 65 percent water, and tomatoes are about 90 percent water. Yet, water is not a major building block of life. Ex
mote1985 [20]
Water cannot carry out the release of energy that is needed to complete chemical reactions necessary for the functions of life.
8 0
3 years ago
In a paragraph below, explain at least three key pieces of information about the moon.
Vinvika [58]
The Moon is the only natural satellite of the Earth. With an equatorial diameter of 3476 km, it is the fifth largest satellite in the solar system, while in terms of proportional size with respect to its planet it is the largest satellite: a quarter of the diameter of the Earth and 1/81 of its mass. I hope I have helped you and if you do not forgive
6 0
3 years ago
Read 2 more answers
The issue of high cholesterol can sometimes run in families. If an individual has two normal alleles, then he is phenotypically
statuscvo [17]
In the case of the gene that determines high cholesterol in the blood, the two alleles express incomplete dominance.
What this means is that the dominant allele is not completely dominant over the recessive allele. If the allele was completely dominant, even one allele would be enough to determine the individual's trait as dominant. But in the case of incomplete dominance between the alleles, the heterozygous individuals that have one dominant and one recessive allele are an ''in between'' phenotype.
5 0
3 years ago
Read 2 more answers
For the moment magnitude scale, each increase on the scale represents 31.5 more energy released by the earthquake. Which is a go
nadya68 [22]

Answer:

27,000

Explanation:

The provided statement talks about an estimate of energy release by an Earthquake with a magnitude of 4 to a magnitude of 7. According to the statement, for the moment magnitude scale, 31.5 times more energy is released with increase of one magnitude scale. Therefore, if we take a rounded value of 31.5 as 30 and multiply it three times (30 X 30 X 30) to represent 3 scales (4 to 7) on moment magnitude scale, we will get 27,000 times more energy.

8 0
3 years ago
Other questions:
  • Forensic anthropologists: a. ​apply anthropological techniques to legal matters. b. are primarily concerned with the recovery of
    5·1 answer
  • Where do you find tundra?
    9·1 answer
  • Compare and contrast glaciers and sea ice
    8·1 answer
  • While on the beagle, darwin was influenced by a book by charles lyell that suggested that earth was __________ and sculpted by g
    13·1 answer
  • The amazing success of science are because scientists have followed the rules of science true or false?
    11·2 answers
  • 2. Describe any Species Recovery Plan, environmental guidelines, or steps taken for recovery of the
    5·1 answer
  • I will give brainleist In a nuclear power plant, where does the generator get its energy to operate?
    9·2 answers
  • PLEASE HELP!!! What term refers to all of organisms' genes
    8·1 answer
  • Why isn’t the remaining sugar in alcoholic fermentation converted to ethanol and carbon dioxide.
    12·1 answer
  • The ___ of the brain is most affected by alcohol abuse.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!