1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yan [13]
3 years ago
14

1. DNA base sequence: GACGATGTAGCATCGACCATTG.

Biology
1 answer:
prisoha [69]3 years ago
3 0
CUGCUACAUCGUAGCUGGUAAC
You might be interested in
What is the volume of 0.25 mol of ammonia gas at 1.00 atm and 273 K? (R= 0.0821 Latm/molK)What is the volume of 0.25 mol of ammo
ICE Princess25 [194]

Answer:

5.6L

Explanation:

Given parameters:

number of moles  = 0.25mol

pressure on gas  = 1atm

temperature  = 273K

Gas constant R = 0.0821Latm/molK

Unknown:

Volume of gas  = ?

Solution:

Using the ideal gas equation, we can solve this problem. The equation is a combination of the three gas laws: Boyle's law, Charles's law and Avogadro's law.

It is mathematically expressed as;

             PV = nRT

where P is the pressure

           V is the volume

          R is the gas constant

          T is the temperature

          n is the number of moles

All the parameters are in the appropriate units and we simply solve for the volume of the gas;

                1 x V = 0.25 x 0.0821 x 273

                      V  = 5.6L

4 0
3 years ago
"Totipotency lasts for only a few days before the cells' fates are set as being the precursors to a specific lineage of cells."
musickatia [10]

Pre-embryonic cleavages make use of the abundant cytoplasm of the conceptus as the cells rapidly divide without changing the total volume.

4 0
3 years ago
Plz help asap!!! i’ll give brainlest!
photoshop1234 [79]
The answer is carbohydrate
4 0
3 years ago
Read 2 more answers
True or false the water table is the lower surface of a aquifer
8090 [49]

Answer:

True

Explanation:

Groundwater is the water present beneath Earth's surface in soil pore spaces and in the fractures of rock formations. A unit of rock or an unconsolidated deposit is called an aquifer when it can yield a usable quantity of water. The depth at which soil pore spaces or fractures and voids in rock become completely saturated with water is called the water table. Groundwater is recharged from the surface; it may discharge from the surface naturally at springs and seeps, and can form oases or wetlands. Groundwater is also often withdrawn for agricultural, municipal, and industrial use by constructing and operating extraction wells. The study of the distribution and movement of groundwater is hydrogeology, also called groundwater hydrology.

hope it helps you

6 0
3 years ago
Read 2 more answers
Do we get all of our energy from the sun
N76 [4]
Im pretty sure that if we got all of our energy from the sun then there would be no energy at night so no


8 0
3 years ago
Read 2 more answers
Other questions:
  • On reviewing the medical reports of a postpartum patient, the nurse finds that the patient has homans' sign. what does the nurse
    8·1 answer
  • Where do female pillbugs carry their young
    13·1 answer
  • You analyze a DNA sample and find that its base composition is 30% A, 20% T, 30% G, and 20% C. What can you conclude about the s
    9·1 answer
  • Need help. ASAP What are considered characteristics of science? Select all that apply. - Scientific experiments are not falsifia
    6·1 answer
  • If you fill up a balloon with a small amount of air, then set it in direct sunlight, you will see that the balloon expands. This
    6·1 answer
  • How many of the animal phyla include single celled animals?
    14·2 answers
  • I need someone to type up a bit on natural selection and population dynamic. Specifically how genetic variations of trait may in
    8·1 answer
  • What was the difference between Darwin and Lamarck? A. The idea of mutations was understood by both, but Lamarck was able to pro
    9·2 answers
  • সরিষা এবং কুমড়া গাছে স্বপরাগায়ন কেন হয়?পর পরাগায়ন কেন হয়না?
    6·1 answer
  • Discuss the special consideration and care needed by tree crops.​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!