1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
user100 [1]
3 years ago
13

1. The insertion site for the sternocleidomastoid is

Biology
2 answers:
Elina [12.6K]3 years ago
5 0

Answer:

D  All of the above

VMariaS [17]3 years ago
4 0
The answer is all above
You might be interested in
Location where photosynthesis takes place in a cell...
vova2212 [387]

Answer:

D

Explanation:

chloroplasts aids in the process of photosynthesis

5 0
3 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Why are old growth forests considered “healthy” ecosystems?
Pavlova-9 [17]
Because they have not been distrubed
6 0
3 years ago
Astralia is surrounded by water with climate change it is at risk of?
Mekhanik [1.2K]

Answer:

As earth’s temperatures increase with climate change, the polar ice caps melt and the sea levels rise, leaving islands like Australia at risk of flooding and partial, permanent underwater submersion.

5 0
3 years ago
If ssb is not present during dna replication, what would you expect to see?
In-s [12.5K]
A. SSB prevents reannealing of the separated strands, so strands would quickly reanneal and DNA replication cannot proceed.

Single-stranded binding proteins, or SSB, appear on the strands to separate the strands. Without a separation force, the strands would simply bind back together through hydrogen bonding.

The answer is a .....hope I helped
5 0
3 years ago
Other questions:
  • Your friend is trying to convince you that if the ligaments binding the bones together at your freely movable joints (such as yo
    13·2 answers
  • Replace with new samples of the powders and repeat, this time adding drops of the base. Record observations in the table.
    13·1 answer
  • How does a solution become saturated?
    13·2 answers
  • Which statement correctly describes a difference between photosynthesis and cellular respiration? Photosynthesis produces carbon
    13·2 answers
  • If your marine toilet has a "y" valve, what must you do in a no discharge zone?
    12·2 answers
  • Each of the following relates to an aspect of evolution by natural selection. Explain the following. ii. Natural selection and t
    11·1 answer
  • What best describes meiosis
    15·2 answers
  • The liver cells of cats contain 48 chromosomes. After meiosis is complete, how many chromosomes are in the new daughter cells?
    13·1 answer
  • Why are the strands of DNA said to be anit-parallel?
    7·1 answer
  • Supplemental appendix is to a book as a ____________ is to a bacterial chromosome. genetically modified organism plasmid restric
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!