All categories

3 years ago

One Strand of DNA is listed below. Which of the following best

Biology

1 answer:

omeli [17]3 years ago

3 0

Answer:Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG Gln

AAG Lys

GAG Glu

TCG Ser

TTG Leu

TGG Trp

TAA Stop

TAT Tyr

TAC Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain. The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized. The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA. The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit. The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True. For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate. Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product. With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

Explanation:

You might be interested in

What are 3 environmental factors in the natural reserve that affect which mice in a population survive to produce

Vanyuwa [196]

I am sorry I need points ok

5 0

3 years ago

How are scientific processes important in solving problems? Give an example and EXPLAIN how these processes make solving this ex

xeze [42]

Scientific process

A step by step procedure of solving a problem is known as scientific process.

Explanation

To solve a problem following steps should be followed: Identification of problem through observation, Development of hypothesis, Experimentation to test hypothesis, Analyze the result of experiment, Conclusion to choose the best possible solution.

Example

1. Identification of problem through observation

Development of agriculture industry lead to soil pollution in the form of heavy metals which cause serious pose to human health. Data collected from environmental department show that heavy is adding day by day in the form of sewage drained from industries in to water, which has also affected aquatic life.

2. Development of hypothesis

Many strategies have been developed for cleaning or removal of heavy metals from soil such as cultivation of heavy metal tolerant plants, installation of plants which filter sewage water before entering into water table, use of bacteria that clean soil from heavy metals.

3. Experimentation to test hypothesis

To test hypothesis and experiment will be set up based on above mentioned method. However main focus should be given on cost, time and environmental friendly approach. To grow heavy metal accumulator plants will cost less but time consuming and after harvesting if their biomass is disposed off, it will again add heavy metals to soil. It is cost effective but time wasting process. Installation of plant to filter sewage is better method but it is cost effective and filter should be changed after a month which cost too much. The use of heavy metal tolerant bacteria is not too costly and once when they enter to soil having heavy metals will absorb heavy metals and will convert them into less toxic form. These bacteria will also reproduce and produce more offspring which will help in cleaning of soil

4. Analyzing result

It was observed in the results that use of plant of clean heavy metal is time wasting process. Similarly, installation of plant is also cost effective, however the use of bacteria for remediation of heavy metal is less costly and not harmful for environment.

5. Conclusion

It was concluded from results that bacteria should be applied for bio remediation purposes.

3 0

3 years ago

The following statement is false. Select the rewording that makes the statement true.

vichka [17]

D) Robert Hooke first discovered cells when observing cork under the microscope.

4 0

4 years ago

The ph of human blood is maintained at around ph 7.4. why does a buffer system need to be present in blood to protect against ch

lilavasa [31]

<span>The metabolic processes in the body generate acids - for example lactic acid from anearobic respiration. The blood must be buffered against these acids to prevent them from raising the pH of the blood. Raising the pH of the blood would result in less biologically optimal conditions for tissues, cells and functionally critical enzymes in the bloodstream. For example, blood clotting may not work at very low (ie very acidic) pH.</span>

3 0

3 years ago

When distilled water is added to plant cells it grows but when added to animal cells it burst, what is the cause?

andrew11 [14]

First, we have to understand why the cell grows or burst.

This is because theres something called osmosis, it is where water molecules will flow from a region of higher water potential to a region of lower water potential through a semi permeable membrane.

As said, which means when a cell is placed in distilled water, the cell membrane is a semi permeable membrane, which only some substance can pass through. And distilled water has a higher water potential than the cell cytoplasm, therefore the water molecules will flow from the distilled water to the cell inside.

So why does the consequences of animal cell and plant cell is different?

When water enters animal cell, the cytoplasm gains water, it gains so much water that the cell membrane cannot hold all water, the cell burst.

However, in plant cell, outside of the cell membrane, theres still something called a cell wall. It doesn't break. So when water enters the plant cytoplasm, the cell membrane expands and pushes against the cell wall, but not breaking. Therefore the cell looks like it grows and becomes turgid.

8 0

3 years ago