1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex73 [517]
3 years ago
15

How repair (replacement) is related to cell division?

Biology
1 answer:
ololo11 [35]3 years ago
7 0

Answer:

cells wear out and die, so cell division creates replacement cells for the cells that are no longer functioning(aka have died).

Explanation:

I took Biology awhile ago, so this information may be a tiny bit off.

You might be interested in
1. You feel thirsty so you drink a large glass of water. A short time after
lubasha [3.4K]
Respiratory

:)))))))))6
4 0
3 years ago
Read 2 more answers
According to Mendel's law of segregation, different alleles are separated into different gametes, or sex cells. According to the
Julli [10]
According to Mendel's law of independent assortment, it says that gametes are sorted independently from one another from alleles of different genes. In simple terms, the alleles a gamete received from different gene do not influence each other. Hope this helps you.

6 0
3 years ago
Read 2 more answers
Vaccines can help protect against viruses by triggering the production of
user100 [1]
Vaccines can help protect against viruses by triggering the production of _____.
"antibodies"

Hopefully this helped hun ! Have a good day!
3 0
3 years ago
Read 2 more answers
Following glycolysis and the citric acid cycle, but before the electron transport chain and oxidative phosphorylation, the carbo
storchak [24]

Answer:

D- NADH

Explanation:

Nicotinamide Adenine dinucleotide, is a co-enzyme which get reduced with hydrogen atoms from Kreb;s Cycle. Flavin Adenine   dinucleotide  is another co-enzymes(FADH2),

Generally, NADH2 transports hydrogen atoms into the matrix of mitochondria.

The hydrogen is spit to protons and electrons.

The protons are pumped by  the proton motive force(PMF) from the matrix into the intramembrane spaces.

The high concentration of  protons sets up electrochemical gradients, which supplies  the energy  needed for ATPs synthesis by ATPase enzyme, as the proton diffuses down the electrochemical gradient back into the matrix.

Therefore the energy from glucose is inform of  NADH, and this has been harnessed , for ATPs synthesis.

3 0
4 years ago
Cyklin dependant kinases are proteins that work with
ZanzabumX [31]

Explanation:

Cyklin dependant kinases are proteins that works together with a group of molecules known as Cyclin Dependent Kinase (CDK) which determines the progression of cell through checkpoints.

7 0
3 years ago
Other questions:
  • Are the youngest rocks found far from the mid-ocean ridges
    13·1 answer
  • ELISA immunoassay experiment
    11·1 answer
  • What do cells have a plasma membrane please!
    14·1 answer
  • What were three impacts on modern animals that came from the Cambrian Explosion?
    15·1 answer
  • Which describes a potential benefit for the environment that stems from genetic engineering?. A. harm to nontarget organisms. B.
    11·2 answers
  • Elements in the same period have the same ________________________.
    7·2 answers
  • What element is found in proteins,but not found in carbonhydrates
    12·1 answer
  • Which of these is an indicator of the age of a woody plant?
    14·1 answer
  • Apply Concepts Eventually, most people with Alzheimer's disease lose the ability to recognize common objects. Explain which lobe
    7·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!