1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jonny [76]
3 years ago
14

It is estimated that fear than 100 Florida Panthers are still living. Florida now has a protected habitat for the panther. Make

a claim about how protecting the habitat will affect the panther population. Provide reasoning to support your claim
Biology
1 answer:
andrew11 [14]3 years ago
6 0

Answer:

This is true as habitat protection involves ensuring the availability of certain resources that helps in the optimal thriving and survival of the animals.

Protecting the habitat will affect the panther population by increasing it. This is because habitat protection will ensure the animal is in the most suitable environment which makes it easier for it to get basic resources such as food, water etc. This is why environmental protection is very important to prevent extinction of the animals .

You might be interested in
The large, leaf-shaped piece of elastic cartilage that is attached to the anterior rim of the thyroid cartilage and forms a lid
trasher [3.6K]
The epiglottis. It prevents food from entering the respiratory tract
6 0
3 years ago
Suppose two suspects in a crime have DNA profiles that match the one DNA fragment tested. what should happen next?
Varvara68 [4.7K]
<span>The sample taken from the crime scene should be analyzed for multiple DNA fragments</span>
3 0
3 years ago
Read 2 more answers
How many times does the calvin cycle have to turn to make one glucose molecule
Maurinko [17]

Answer:

Im not sure what are the choices?

Explanation:

4 0
3 years ago
The man responsible for devising the modern scientific classification system still in use today is ______ .
ella [17]
<span>a. he was born in 1707 and died in 1778.</span>
3 0
3 years ago
For ingested foods, the first opportunity for enzymatic digestion occurs in the _____. see concept 41.3 (page 903)
yKpoI14uk [10]

Answer;

The mouth


For ingested foods, the first opportunity for enzymatic digestion occurs in the mouth.


Explanation;

The digestion of food starts in the mouth.

There is both mechanical and enzymatic digestion of food in the mouth. Mechanical digestion involves the mechanical break down of food using teeth to smaller particles thus increasing the surface are for the activity by enzymes.

Enzymatic digestion in the mouth involves enzyme salivary amylase which acts on starch to form maltose.

3 0
3 years ago
Other questions:
  • How are human activities disturbing carbon dioxide levels and affecting marine life?
    10·2 answers
  • How is the white blood cell adapted to do its job
    15·1 answer
  • In which layer is the temperature the lowest?
    6·1 answer
  • ¿cual es el porcentaje de timina del total de las bases nitrogenadas del ADN
    7·1 answer
  • HURRY PLEASE
    13·2 answers
  • HURRY, i need to know the order
    11·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Suggest one advantage and one disadvantage of<br>using a dichotomous key to identify something.​
    11·1 answer
  • What is biological diversity??? I have a test on It plzzz help!!!!​
    5·1 answer
  • Why Should We Add Crickets In Our School Lunches? <br> Introduction
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!