1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
777dan777 [17]
3 years ago
14

Which row in the chart below contains the words that best complete this statement?

Biology
1 answer:
katovenus [111]3 years ago
6 0
The answer is C I don’t think this needs more explanation but if needed just ask!
You might be interested in
Sometimes the color of an animal closely resembles the color of its environment. Which of the following is the most likely reaso
zaharov [31]
The answer is D, because it is a form of camouflage and an adaptation to the environment for self defense
3 0
3 years ago
Read 2 more answers
What are the possible adulteration and possible deterioration of Curcuma longa (Turmeric) ?​
mojhsa [17]
<h3><u>Turmeric powder can be adulterated in many different ways:</u></h3>
  • Curcuma longa(Turmeric) is a strong base and is used as a domestic product.

<u>The possible adulteration and deterioration of Curcuma longa are as follows</u>:

  • It can be mixed with chalk powder which results in production of small bubbles.
  • When turmeric powder is mixed with water, it produces some streaks of soluble colour in water that is caused as a result of adulteration of lead chromate in turmeric powder.
8 0
3 years ago
The liquid mixture in which all substances are evenly distributed
butalik [34]

Answer:

In a homogenous mixture all the substances are evenly distributed throughout the mixture (salt water, air, blood).

Explanation: i think this is right

5 0
3 years ago
Can someone explain anticondons?<br><br>Don't answer right away, got to add pictures.
Greeley [361]

Answer: A codon is found on the coding strand of double-stranded DNA and in the (single-stranded) mRNA. ... The anticodon is found on the tRNA and is the part that base-pairs with the codon (on the mRNA) in order to bring the appropriate amino acid to the ribosome to be added to the growing peptide chain.

7 0
2 years ago
True or false: animals and plants can both carry out respiration
stich3 [128]

Answer:False

Explanation:

This is false since light energy is needed for photosynthesis to take place. ... Animals are capable of respiration, but not photosynthesis.

Hope this helped!

5 0
3 years ago
Read 2 more answers
Other questions:
  • If the sequences of bases of one strand of a DNA molecule is TAGTCA, what is the sequence of complementary bases in the other st
    14·1 answer
  • What is the source of the carbon atoms in glucose molecule?
    11·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Describe carolus linnaeus (who was he) and his classification system (why was it needed). be specific.
    11·1 answer
  • What can insects do that no other arthropod can do
    12·1 answer
  • Select all of the answers that apply. Which of the following are possible causes of mass extinctions that scientists have identi
    7·2 answers
  • Which factor is required for genetic equilibrium?
    14·2 answers
  • What is the term for a preserved footprint left behind any animal
    9·1 answer
  • Question 4 Multiple Choice Worth 1 points)
    12·1 answer
  • The pressure you exert on the floor decreases when you stand on your toes because the area on which you exert force decreases.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!