1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aivan3 [116]
3 years ago
5

Anyone able to help?!

Biology
1 answer:
frutty [35]3 years ago
5 0

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

 

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

 

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

 

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

 

 

2. Below is a table for the genetic code:

 

 

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

 

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

 

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

 

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

 

 

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

 

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

 

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

 

 

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

 

b. False, a frameshift mutation affects all the subsequent amino acids.

 

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

 

d. False, the wobble is first base (5’ to 3’) in the anticodon.

 

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

 

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

 

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

 

 

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

 

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

 

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

 

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

 

 

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

 

Explanation:

:)

You might be interested in
When conducting scientific research or experimentation, researchers carefully analyze and evaluate results to determine a valid
Igoryamba
The answer is actually D. I just took a test 
8 0
4 years ago
Read 2 more answers
If thymidine dimers created by UV irradiation persist until DNA replication, DNA polymerase is likely to make a mistake reading
marishachu [46]

Answer:

Thymidine dimers is likely to be repair as soon as it is originated but if left unrepaired then it causes  frame shift mutations.

Explanation:

In case of Bacterium if UV irradiation induces covalent linkage of two thymidine present adjacently to each other or on a single strand to make thymidine dimers.

These either excised via DNA repair enzyme like Endonuclease V and the proof reading activity of DNA polymerase I enzyme help in incorporation of nucleotide by taking the unmutated original strand as a template.

These dimers if not excised before second round of replication than the sequence of newly synthesized strand will be altered. As DNA polymerase III enzyme read thymidine dimers as single thymidine nucleotide and incorporate only 1 adenine in the newly synthesizing complementary strand which results in frame shift mutations

It is the mutation in which reading frame of codons is shifted or altered due to deletion or addition of a single nucleotide.

7 0
3 years ago
Why would engulfing these smaller prokaryotic cells be an advantage to the larger prokaryotic cells? A) The smaller prokaryotic
Lana71 [14]

Answer:

The answer is D

Explanation:

3 0
3 years ago
I need some help with this question
AleksAgata [21]

Answer:

the food chain is more stable and lasting

Explanation:

where there is an ecosystem with lots of plants and animals you get a stable food chain. where there are fewer plants and animals most animals have to compete with other animals for food.

8 0
3 years ago
Omg can someone plz help me?
AysviL [449]

Answer:

Shale is not a metamorphic rock it is actually a rock that is made during the process of making slate

Explanation:

Pls give me brainliest if it is right, i hope you have a blessed day amigo!!

3 0
3 years ago
Other questions:
  • The imaginary “line” created when the body is divided into equal right and left halves is called the
    12·1 answer
  • Stable ecosystems can be altered, either rapidly or slowly, through which of the following events?
    6·1 answer
  • A carbohydrate molecule is (2 points) a macromolecule made of amino acids that provides structure for a cell and is not soluble
    5·1 answer
  • Please help me. I need more than just one example on this graded assignment. I'm stuck AF..
    6·1 answer
  • What energy systems does your body use to support the 100s trial in the experiment? refer back to information presented in activ
    10·1 answer
  • Which of the following consists of more than just proteins?
    13·2 answers
  • The location of plate boundaries is most helpful in predicting the location of
    14·1 answer
  • O que é teoria panspermia?​
    9·1 answer
  • Where does the energy go after it reaches the top predators?
    7·1 answer
  • Quiet metabolic activities account for about ________ of the average person’s daily energy expenditures
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!