1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mazyrski [523]
3 years ago
12

A small group of diploid triangular Sticky Notes were fluttering along the coast of The Mainland. A storm blew in and blew the S

ticky Notes to an isolated island that had never previously been inhabited by Sticky Notes. After a few years, the Sticky Note population (though still small) has happily made the new island their home and are visited by an evolutionary biologist. The evolutionary biologist bands the Notes, collects tissue for a genetic analysis, and finds that this isolated population of Notes is not in Hardy-Weinberg equilibrium. Why is this, and what may be the potential long-term significance
Biology
1 answer:
muminat3 years ago
5 0

Answer:

Because genetic drift (Founder effect) is acting on this population. Not all the Hardy weinberg criteria are accomplished. There are no random matings and populations are finite-sized.

Explanation:

This is a special case of genetic drift: the founder effect.

The “Founder effect” phenomenon refers to cases where a new population originates from a few founder individuals, coming from a bigger ancestral population, that established in a new environment. This small population might or might not be genetically representative of the original one. This subgroup carries with them some genetic information that they share with their original population. Over time, some genes can be lost, or they can increase in frequency. Some rare alleles might be exceeded or might be completely lost. On Consequence, when the small population grows, it will have a genetically different composition from the original one. In these situations, genetic variability is reduced and enhances the possibility of developing a peculiar allelic composition. In some cases, the founder effect is part of the process of speciation.  

The criteria for maintaining a Hardy-Weinberg equilibrium are:  

  • Random matings
  • No superposed generations
  • No mutations
  • No migration  
  • Infinite population size
  • No natural selection

Genetic drift involved the un-accomplishment of random matings and infinite population sizes.

Genetic drift involves:

  • limited population sizes
  • individuals reproduce by endogamy/exogamy, and matings occur by phenotype.

You might be interested in
Based on the chemical equation, use the drop-down menu to choose the coefficients that will balance the chemica
Olenka [21]

Answer:

2,2, and 1.

Explanation:

I did the assignment and got the answer right.

4 0
3 years ago
Read 2 more answers
Explain how a sprinter gets energy during a 30-second race. Is the process aerobic or anaerobic? How does it
lord [1]

Answer:

sprint runners rely on lactic acid fermentation as there main source of energy,printing takes a lot of effort and a lot of big movements  and a lot energy on demand . cellular respiration makes ATP at a slower rate than lactic fermentation therefore it is anaerobic

Explanation:

the sprinter uses ATP already in muscles as well as ATP produced by lactic acid fermentation. A long-distance runner gets its ATP solely off of cellular respiration

hope this helps

3 0
3 years ago
Which of the following solutions would have the lowest freezing point? 1.0 M NaCl, 3.0 M NaCl, 2.0 M NaCl, 2.0 M NaCl, 0.5 M NaC
Nady [450]
0.5 NaCI or 1.0 NaCI
8 0
3 years ago
Is a zoonotic infection that can be contracted by people who handle birds.
Anna71 [15]

Answer: Yes, the zoonotic is the infectious diseases that can be contracted by the people who handle birds.

Explanation:

Zoonotic is the infectious diseases that can be transmitted through birds. Highly infected birds are infectious to the other organism as, it is transmitted from one person to another.The zoonotic infection are caused by the viruses, fungi and bacteria.

Example of zoonotic disease are:

  • Animal flu and bird flue
  • Anthrax
  • Cat scratch fever
7 0
4 years ago
Human hormones testosterone and estrogen are considered lipids. What could be the reason for this? A. They are phospholipids. B.
olga2289 [7]

Answer:

C. They are steroids

Explanation:

Steroids are lipid hormones and estradiol, which is also known as estrogen, and testosterone. These are sex hormones that are derived from cholesterol, so they are lipids and they share the same characteristics as well, being both fatt acid chains and are insoluble in water. Estrogen is the female sex hormone, while testosterone is the male sex hormone.

5 0
3 years ago
Other questions:
  • Excertion is best described as the removal of what​
    6·2 answers
  • Organisms produce their own energy or provide energy for other organisms in a food chain. Yellowfin tuna, or Thunnus albacores,
    10·2 answers
  • HELP!!!!!!!!!!!!!!!!!!!!ASAP!!!!!!!!!!!!!!!
    11·1 answer
  • Which parameter of the hydrosphere always remains constant
    7·2 answers
  • Which type of experiment did he conduct to answer his question
    13·1 answer
  • What indicates that a b cell or t cell has developed immunocompetence?
    9·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Members of different species do not produce offspring due to:
    8·2 answers
  • PLEASE HELP WORTH 20 PTSSSS
    12·2 answers
  • Would this make sense? A dogs eye color was brown which his allele coded for
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!