1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
borishaifa [10]
3 years ago
14

PLEASE HELP ASAP!!! WILL MARK BRAINLIEST!!!

Biology
1 answer:
Mice21 [21]3 years ago
8 0
1: a) Cytokinesis

2: b) Prophase: Fibers form the mitotic spindle

3: It is the system that scientists use to name living organisms. It is beneficial to use this naming system because it is very precise and narrows it down to one specific organism. Another reason is because the roots used to make up one of the names can be compared to others, so you can see the relationship between two different organisms.

4: a) <span>Organisms once thought to be unrelated may be found to be related.

5: b) eliminating waste through the cell membrane.

I hope this helps you out.
</span>
You might be interested in
Many cells make and use an enzyme, called catalase, to facilitate the decomposition of hydrogen peroxide (H2O2). The products of
Len [333]

Answer:

A. It decreases the activation energy needed to start the reaction

Explanation:

Organic catalyst which speed up the rate of organic chemical reaction is living cells are called enzymes.They have specific reaction site called active sites.This must be in prefect shape with the substrate for the organic chemical reaction to take place

When this occurs the minimum amount of  energy of  reaction to  activate or stimulate  the the atoms and molecules of the substrate to undergo chemical reaction is  lowered.This energy of reaction is celled activation energy.

Catalase thought its active sites lowers the activation energy so that the molecules of H2O2 could break down to C02 and H2 faster,thereby reducing the time for theses product to form.The is the general roles of enzyme.To increase the rate of chemical reaction,by reducing the activation  energy.

8 0
3 years ago
In what ways does one biotic factor interact with the abiotic factors????
babymother [125]

Answer:

Soil getting dug up by moles.

6 0
3 years ago
1+1=?<br>"only wrong answer"​
hoa [83]
5 Windows, 3 ants, 36 closets
4 0
3 years ago
Ribosomes attaches to the smooth ER make proteins? True or False
Pavlova-9 [17]
Answer:

True.

Explaination:

I’ve done this before.
7 0
3 years ago
Which field of biology studies the structures of different species of animals?
Lunna [17]
Comparative anatomy’s
8 0
3 years ago
Read 2 more answers
Other questions:
  • If a scientist is looking at the size, temperature, brightness, and composition of a star, he may be studying the star’s
    13·1 answer
  • A population of viruses with similar characteristics is called a _____.
    6·2 answers
  • BRAINLIEST YOU WILL GET BRAINLIEST
    5·2 answers
  • Where would muscle A in the image set most likely be found?
    8·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • How a renewable resource can run out?
    14·1 answer
  • Pls help it’s for science
    15·2 answers
  • Question 7 0410
    5·1 answer
  • What do lung cancer And emphysema have in common
    7·2 answers
  • Reef-building coral are marine animals with single-celled algae living in their tissues. The coral provide protection for the al
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!