1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dmitry [639]
2 years ago
13

7. Which of the following statements is incorrect?

Biology
1 answer:
sweet-ann [11.9K]2 years ago
6 0
3.Even though there are some dna traces in the mitochondria,it’s won’t really be tested for gcse and mostly the DNAs are found in the nucleus of the cell.
You might be interested in
A lichen is a combination of fungus and algae that lives on the sides of trees, rocks, and other materials. The fungus provides
Softa [21]

Answer:

Mutualism

Explanation:

Organisms in an ecosystem interact with one another from time to time. The close interaction between two organisms is referred to as SYMBIOSIS. Symbiosis is of different types depending on the how it affects the involved organisms. The example in this question depicts MUTUALISM.

Mutualism is the type of symbiotic relationship between two organisms in which both organisms benefit from the relationship. This is the case of the LICHEN, which involves the Algae and Fungi. The algae benefits by making use of the water and minerals supplied by the fungi while the fungi benefits by using the food the algae produces via photosynthesis.

8 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
What is the necessary when classifying a star
kifflom [539]
Luminosity, and color.
3 0
3 years ago
If the Sun and volcanoes were controlling the climate, the climate would
Neporo4naja [7]

Answer:

<em>The correct option is B) undergo global warming at the same rate as we are seeing currently</em>

Explanation:

The Sun and the volcanoes play a great role in controlling our environment and climate even today. The quantity of the rays of the sun hitting the different parts of the Earth determines what the average weather or climate of a region would be. The volcanoes that erupt from the Earth have been a cause for global warming even today and will continue to raise the temperature of the Earth.

7 0
3 years ago
In humans, which tissues are the main storage locations for glycogen? select all.
Paha777 [63]

Answer:

Cuando el cuerpo no necesita usar la glucosa para generar energía, la almacena en el hígado y los músculos. Esta forma almacenada de glucosa se compone de varias moléculas conectadas entre sí y se llama “glucógeno”.

Explanation:

3 0
2 years ago
Other questions:
  • 1. Write the part of the brain that performs each of the functions shown below. (2 points) Regulates sleep Connects brain and ey
    13·2 answers
  • What is lactic acid?
    14·2 answers
  • What happens to a virus involved in the lysogenic cycle?
    8·1 answer
  • What kind of organism is the second one in the following food chain?
    15·1 answer
  • 2. _______ are deep valleys with cliffs or steep slopes along their sides. Canyons Volcanoes Ranges Alluvial fans
    13·2 answers
  • Scientific _______ are logical conclusions that are drawn from scientific observations.
    13·2 answers
  • Local authorities need to be on the lookout to stop hazardous waste _____ who get around laws using tactics such as bribes, fals
    10·1 answer
  • Lichens that colonize bare rocks are an example of a pioneer
    7·1 answer
  • Plz help thanks ! Question is - ADH THEN ACTS ON THE KIDNEY TO?
    7·1 answer
  • Which best desribes how parents affect the genotype
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!