1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
koban [17]
3 years ago
9

What ideas were changing in the scientific community at the time Darwin travels

Biology
1 answer:
Stels [109]3 years ago
6 0

Answer:

One Idea was the appreciation that the age of the Earth was much greater than had hitherto for been imagined.

You might be interested in
Is it living or nonliving?
defon

Answer:

nonliving

Explanation:

because it's a stone

5 0
2 years ago
Read 2 more answers
Difference between emphysema and chronic bronchitis
Luba_88 [7]
The difference is that emphysema and chronic bronchitis are different types of chronic obstructive pulmonary disease (COPD).  <span />
5 0
3 years ago
Which stage is the last stage of speciation?
MrRa [10]
D is the correct answer. Hope this helps.

5 0
3 years ago
Read 2 more answers
Which statement correctly uses the model above to explain how mitosis maintains genetic continuity? A. The chromosomes in cell 1
Bezzdna [24]

Answer:

B

Explanation:

8 0
3 years ago
In which part of the cell do ribosomes complete protein synthesis?​
olga nikolaevna [1]

Answer: nucleus

Explanation:  In eukaryotes, ribosomes get their orders for protein synthesis from the nucleus, where portions of DNA (genes) are transcribed to make messenger RNAs (mRNAs). An mRNA travels to the ribosome, which uses the information it contains to build a protein with a specific amino acid sequence.

6 0
2 years ago
Read 2 more answers
Other questions:
  • What is meant by the phrase "plants are green factories"?
    9·2 answers
  • Certain animal species that are endangered or
    11·1 answer
  • The map shows concentrations of ozone around the world. Ozone shields Earth from harmful ultraviolet light rays from the sun, wh
    6·2 answers
  • What type of evolution is illustrated by many species developing from one common ancestral species?
    7·1 answer
  • The first organisms evolved on Earth around 4 billion years ago. The fossil record indicates that the first organisms were which
    6·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • How to use ribosome in a sentence
    5·1 answer
  • Once blood delivers oxygen, what does it pick up from cells on its way back to the heart?
    14·2 answers
  • A piece of wood that measures 3cm by 6cm by 4cm has a mass of 80g.
    15·1 answer
  • The rolls at the environment place in determining which species survive is referred to as what
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!