Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Answer:
The nervous system regulates breathing and heartbeats but it's also responsible for regulating the core temperature of the body. So when conditions are too warm or hot and body temperature rises, the blood vessels can dilate causing heat loss. Nerves can trigger sweat glands to release fluid that evaporates and cools the skin so that body temperature begins to lower to a normal condition.