1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
inna [77]
2 years ago
6

How is the carbon cycle related to global warming ?

Biology
1 answer:
alexdok [17]2 years ago
7 0

Answer:

The carbon cycle plays a key role in regulating Earth's global temperature and climate by controlling the amount of carbon dioxide in the atmosphere. The greenhouse effect itself is a naturally occurring phenomenon that makes Earth warm enough for life to exist...hope it helps..

You might be interested in
What considerations determine if an animal excretes nitrogenous waste as ammonia, uric acid, or urea
Evgesh-ka [11]

Answer:

A major factor in determining the mode of nitrogen excretion is the availability of water in the environment. Generally, aquatic animals excrete mostly ammonia, whereas terrestrial animals excrete either urea or uric acid.

Explanation:

8 0
3 years ago
Read 2 more answers
Please Please Please Please Help Me With This Science Sheet Homework!!!!!!!!!! Questions 1-4!!!!!!
Mkey [24]
1. The sizes of their necks vary
8 0
2 years ago
He w does your nervous system work?
UkoKoshka [18]
The nervous system<span> is like a  highway along which </span>your <span>brain sends and receives information about what is happening in the body and around it. This highway is made up of billions of nerve cells, or neurons (say new-rons) which join together to make </span>nerves<span>. A nerve is a fibre that sends impulses through the body.</span>
8 0
3 years ago
HELPPPPPPP ILL MARK YOU AS BRAINLIEST
MAXImum [283]

the ice because the albedo value is high

4 0
2 years ago
Ability to roll the tongue is caused by a dominant allele. A woman is a "roller," but one of her parents is not. Reference: Ref
matrenka [14]

Answer:

1/2.

Explanation:

The autosomal dominant trait may en defined as the trait that can express itself even in the heterozygous condition and in the homozygous dominant condition as well.

Let the B allele is responisble for the roll tongue and b is recessive allele. The woman can roll the tongue and she must have the genotype Bb because her one parents is normal. The woman married with a man with non roller ( bb). The Bb × bb cross results in the following progeny Dd, Dd ( roller), dd and dd ( non roller). The probability of the child being a roller is 1/2,

Thus, the answer is 1/2.

5 0
3 years ago
Other questions:
  • Is a tomato a fruit or vegetable
    11·2 answers
  • In which state was less than 50 billion tons of coal mined in 2005?
    13·1 answer
  • Each ATP molecule contains about 1% of the amount of chemical energy available from the complete oxidation of a single glucose m
    5·1 answer
  • What are two possible outcomes (signs or symptoms) that can result when chemical mediators such as leukotrienes and interleukin-
    14·1 answer
  • How is gametes defined as a scientic form. Is it in which it is for example, dominant trait Aa and recessive trait aa are bred t
    15·1 answer
  • 2. When people eat foods high in proteins, such as meat, eggs, and cheese, the body breaks down the
    7·1 answer
  • What is one reason that matter is able to move within earth?
    5·1 answer
  • What is genetic biodiversity?
    5·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Brian is a forensic investigator studying a tool mark on a door jam. He has gone through the steps of collecting the tool mark e
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!