1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dafna1 [17]
3 years ago
7

The trait for sickle cell anemia in humans shows a recessive pattern of inheritance. The alleles for sickle cell anemia in two i

ndividuals are shown below.
Sickle Cell Anemia Alleles
Individual Alleles
C Hh
D hh


Which individual(s) would show observable sickle cell anemia?
Only C
Only D
Both C and D
Neither C nor D
Biology
2 answers:
kupik [55]3 years ago
6 0
Neither C or D, Hh means that C is a carrier but does not have sickle cell.
frutty [35]3 years ago
5 0
C! Hope it’s helps can u help with my question I need help with the numbers 24,25,26
You might be interested in
PLSSSSSSS HELPPPPPPP I WILL GIVE BRAINLIESTTTTTTTTTT!!!!!!!!!!!!!!!!!!!!!PLSSSSSSS HELPPPPPPP I WILL GIVE BRAINLIESTTTTTTTTTT!!!
Flura [38]

Answer:

Lister's work led to a reduction in post-operative infections and made surgery safer for patients, distinguishing him as the "father of modern surgery"

Explanation:

8 0
3 years ago
Read 2 more answers
Mention the different habitats in which micro organisms are found
erastovalidia [21]
The micro organisms are found in
<em><u>hot springs
</u></em>
<em><u>soil
</u></em>
<em><u>snowfield
beneath earth 
rocks
inside roots
swamps
water...
</u></em>

4 0
3 years ago
Read 2 more answers
Explain the characteristics scientists use when observing organisms and placing them in the six kingdoms .
Rus_ich [418]
<span>The characteristics that scientists used to classify living organisms into six kingdoms include the following:
1. Cell type: living organisms are classified into prokaryotes and eukaryotes based on the presence of nucleus and distinct arrangement of the organelles in their cells.

2. Mobility: living organisms are categorized into kingdoms based on their ability or inability to move about.

 3. Cell structure: the cells structure was used to divide living organisms into plants and animals. Those living organisms that have cell wall are classified as plants while those who do not have cell wall are classified as animals.

4. Number of cells: living organisms that are made up of only one cell are classified as unicellular while those with many cells are termed multi cellular.

 5. Reproduction method: living organisms are classified based on whether they reproduce sexually or asexually.

6. Manner of obtaining energy: living organisms that can prouduce their own food are called autotrophs while those that can not produce their own foood are termed heterotrophs. Plants are essentially categorised as autotrophs while animals are described as heterotrophs.</span>
6 0
3 years ago
Brackish water is common in freshwater wetlands... true or false?
Step2247 [10]

Answer:

The correct answer is False

3 0
3 years ago
How frequently can scientists prove that their hypotheses are true?
ZanzabumX [31]
Scientists prove their hypothesis is true about Scientists can never "prove" their hypotheses are true, because some future experiment, possibly using new technology not currently available, might show the hypothesis to be false after all.
4 0
3 years ago
Other questions:
  • Which is the largest gland in the human body? What is its secretion called and what is
    15·1 answer
  • If you isolate a single nucleotide from a nucleic acid and determine that the nitrogenous ring structure is cytosine (C), you co
    5·1 answer
  • Two dangers associated with the exposure of X-ray
    12·1 answer
  • If water were a non polar molecule, how would its properties be different ?
    8·1 answer
  • What has science given to us
    13·2 answers
  • Which of the following best describes how most scientists think humans evolved?
    11·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which type of respiration is the most efficient in producing ATP?*
    11·2 answers
  • The basic difference between lung volume and lung capacities is that
    12·1 answer
  • What do the bubbles in ice cores represent?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!