1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stels [109]
3 years ago
5

How many chromosomes are there in human ovum​

Biology
2 answers:
denis-greek [22]3 years ago
7 0

Answer:

23 chromosomes

Unlike all the other cells in a human body which are diploid, human sex cells are haploid. That means that both sperm cells and ova are haploid; containing only 23 chromosomes.

Explanation:

have a good day!

(─‿─)

Novay_Z [31]3 years ago
7 0

Answer:

The answer is 23 chromosomes Unlike all the other cells in a human body which are diploid, human sex cells are haploid. That means that both sperm cells and ova are haploid; containing only 23 chromosomes

Explanation:

Have a great day

You might be interested in
How could the botanist best determine whether the genotype of the green-pod plant is homozygous or heterozygous?
murzikaleks [220]

Answer:

C

Explanation:

Homozygosity is when the two alleles (gene form) are the same while heterozygosity is when the alleles are of different types.

In a gene, an allele is capable of masking the expression of another. The allele being expressed or that masks is called the DOMINANT allele while the allele being masked is the RECESSIVE allele.

A recessive allele will only be expressed (phenotypically) if the two alleles are of the same type i.e. homologous but when a dominant phenotype is expressed, one cannot ascertain whether the organism is heterozygous or homozygous for that gene. e.g T is the gene coding for height in plant, T which represents tallness is dominant over t, representing shortness. In a heterozygous (Tt) and homozygous dominant (TT) state, the plant will be phenotypically tall but will only be short in a homozygous recessive (tt) state.

Since the plant will be tall in homozygous (TT) or heterozygous (Tt), we cannot detect the actual genotype of the plant. Hence, a test cross is done.

A test cross is a cross between a dominant phenotype and a homozygous recessive in order to determine the actual genotype of the dominant organism i.e. whether homozygous or heterozygous.

In this case involving pod color gene, since the botanist is trying to determine whether the genotype of the green pod plant is heterozygous or homozygous, it means the allele for green pod is dominant over that of yellow pod (recessive).

N.B: The recessive trait can only be expressed if it is homozygous. Therefore, the yellow pod plant has homozygous recessive genotype.

A test cross is conducted by the botanist to determine whether the green pod plant is heterozygous or homozygous by crossing it with a yellow pod plant (homozygous recessive).

If any of the offspring plants exhibit recessive traits i.e. yellow pods, it means the parent green pod plant is heterozygous but if all the offspring plants show phenotypic dominant traits i.e green pod, it means the parent green pod plant is homozygous.

8 0
3 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
In our solar system, why is Earth the planet best suited for life?
QveST [7]

Answer:

It has the right amount of all essential things.

Explanation:

has the right amount of oxygen, gravity, food resources and systems (photosynthesis, cellular respiration,etc.)

8 0
3 years ago
Read 2 more answers
.What might happen to cells with DNA that has been damaged by an environmental influence such as UV light from the sun or a tann
VARVARA [1.3K]

Answer:

It can lead to melanoma or a time of skin cancer.

Explanation:

This is because UV radiation in sunlight can destroy the DNA by destroying the base pairing. UV light will cause two Thymine that are very closer to each other to join together to produce dimer. After which, The melanin-assisted process form lesions that is popularly called cylobutane pyrimidine dimers in DNA, which can result in mutations that cause melanoma which is a form of skin cancer

5 0
2 years ago
Cell engulfs molecules in cell "drinking":
RSB [31]
These are the following answers to the items

cell engulfs molecules in cell "drinking": pinocytosis<span>

molecules helped by protein; move insoluble molecules across plasma membrane: </span>facilitated diffusion
<span>
molecules move in and out freely from high to low concentration: </span>passive diffusion
<span>
cell engulfs microorganisms in cell "eating": </span>phagocytosis<span>

molecules "pumped" in or out from low to high concentration: </span>active transport<span>

oxygen, carbon dioxide: </span>passive diffusion<span>

transports sodium, potassium: </span>active transport<span>

transports glucose, amino acids: </span>pinocytosis
8 0
3 years ago
Other questions:
  • although Darwin did not realize it, the variations he observed among the individuals of a population of finches were caused by w
    9·1 answer
  • A body of granite was found to underlie sandstone. pieces of sandstone were found in the granite. which is younger, the granite
    9·1 answer
  • What is the connection between natural capital, natural income, and an
    6·1 answer
  • In the United States, the parasite that causes malaria is not present, but it is present in African-Americans whose ancestors we
    10·1 answer
  • The skin condition caused by hyposecretion of the oil glands and is an inherited condition is known as
    5·1 answer
  • HELP ME PLEASE!!! Genetics, botany, zoology are all branches of what subject.
    7·2 answers
  • Select the correct location on the image.
    7·2 answers
  • Where did the Parlor Palm originate?
    8·1 answer
  • Join among us code for my insta NBJPZF
    15·1 answer
  • Describe how a magnetic field can produce a change in energy.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!