1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Radda [10]
3 years ago
11

Which bacterial infection is caused by an unusual strain of

Biology
2 answers:
alexandr402 [8]3 years ago
7 0

Dysentery is the right answer.

Further explanation

Bacterial infection

It is a multiplication of a harmful strain of microorganisms on or inside the body. Microscopic organisms can contaminate any zone of the body. Pneumonia and food poisoning are only a couple of diseases that might be brought about by destructive microscopic organisms. Microorganisms come in three fundamental shapes: bar formed (bacilli), round (cocci), or helical (spirilla). Microbes may likewise be named gram-positive or gram-negative. Gram-positive microorganisms have a thick cell divider while gram-negative microbes don't. Gram recoloring, bacterial culture with anti-toxin affectability assurance, and different tests are utilized to distinguish bacterial strains and help decide the suitable course of treatment.

E. coli

Escherichia coli (E. coli) microorganisms typically live in the digestion tracts of solid individuals and creatures. Most assortments of E. coli are not harmful or cause diarrhea. Be that as it may, a couple of especially dreadful strains, for example, E. coli can cause serious stomach spasms, vomiting and diarrhea.

Dysentery  

It is an irresistible infection related with extreme diarrhea. In the United States, signs and side effects are typically gentle and normally vanish inside a couple of days. A great many people won't look for restorative consideration.  

Treatment

Infected person should drink a lot of liquids to avert drying out. In the event that they can't drink, or if vomiting and diarrhea are bountiful, intravenous liquid substitution might be vital. The patient should be admitted in hospital and should be observed.

Answer details

Subject: Biology

Level: College

Key words

  • Bacterial infection
  • E. coli
  • Dysentery
  • Treatment

Learn more to evaluate

brainly.com/question/12887489

brainly.com/question/10560288

brainly.com/question/12603071

Evgen [1.6K]3 years ago
3 0

Dysentery is caused as a result of bacterial infection caused by an unusual strain of E.coli. The E.coli is found normally in the intestine but during infection watery diarrhea along with mucous and blood is there.

Dysentery can also be caused by other infectious pathogens such as bacteria, parasites or viruses. The infection is caused when the pathogen enters the large intestine via mouth due to consumption of contaminated water or food, oral contact with the objects which are contaminated.

The treatment to the infection is through antibiotic drug.

You might be interested in
What are two disadvantages of GMO food?
Y_Kistochka [10]
These are all disadvantages but I would say that A and D or A and B are the most serious ones. 
7 0
3 years ago
Read 2 more answers
(9th grade biology)<br> pls help
jolli1 [7]
B = adds nucleotides
A = unwinds the DNA
C= joins Okazaki
D = tells where to build
4 0
2 years ago
1. ¿Qué es la sociedad civil? ¿Quiénes la conforman? ¿Por qué es importante para la democracia?
Novay_Z [31]

Answer:

La sociedad civil también se llama tercer sector de la sociedad.

Explicación:

La sociedad civil es un tipo de sociedad que se compone de personas que exigen los derechos y deseos del público. También se le llama tercer sector de la sociedad porque es diferente del sector gubernamental y empresarial. Las personas del sector familiar y privado conforman la sociedad civil. Es importante para la democracia porque proporciona control y equilibrio sobre la democracia y evita que el gobierno tome malas decisiones.

4 0
2 years ago
1. What qualifies a fossil to be used to find the absolute age of rocks?
DENIUS [597]

Answer:

too much stuff pls summarize

Explanation:

7 0
2 years ago
Read 2 more answers
The scientific explanation that suggests the universe is expanding relies on two main concepts
laiz [17]
Doppler effect and redshift as the light coming from stars from the distance can be shifted in the same way as a pitch of sound does
4 0
3 years ago
Other questions:
  • This part of the cell is made up of a carbohydrate called cellulose
    9·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What helps move undigested waste materials to help the intestines to function efficiently?
    12·1 answer
  • Which of the following is an example of conformity?
    5·2 answers
  • Which of the following provides the best comparison between fish and birds?
    7·2 answers
  • What does a cell copy in dna replication?
    6·1 answer
  • PLZ help ill give Brainliest
    14·2 answers
  • What changes to the cell cycle causes cancer?
    15·1 answer
  • What is the atomic number of an oxygen atom that has 8 protons in its nucleus?
    13·2 answers
  • What kind of relationship does mistletoe<br> have with the oak tree? Explain your answer.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!