1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aivan3 [116]
2 years ago
15

You see in the back room of the hospital that has two boxes containing two different concentrations of morphine-sulfate NaCl I.V

. dialysis bags. One box has bags of 0.8% NaCl, while the other box has bags of 0.6% NaCl. Which bag has the lowest amount of solute?
Biology
1 answer:
professor190 [17]2 years ago
7 0

Answer: less NaCl in the 0.6% solution bag

Explanation:

1. assume equal concentration of morphine sulphate (mg amounts anyway)

2. Assume both concentrations are either w/w or w/v

3. assume bags are of equal volume

4. 0.8% solute > 0.6% solute

You might be interested in
1) Which of the following explains why a bone in a bird's wing is homologous to a bone in a lizards leg? A) The bones in the two
dangina [55]

Answer:

<em><u>The correct option is D) The two species have a common ancestor</u></em>

Explanation:

In evolutionary studies, homologous structures can be described as structures which are similar in organisms of different species because they had a common ancestor in the past. These structures may not perform the same function but are similar because they arose from a common ancestor. Hence, the bone in a bird's wing can be homologous to a bone in a lizard leg because they have a common ancestor in the past.

5 0
2 years ago
Read 2 more answers
Explain how a streamlined, smooth, nearly hairless body is a beneficial adaptation for marine animals.
lana66690 [7]

Most of the marine animals have a stream lined body, which means, they have a sharp and pointed at the front. The pointed front of the organism allow to cut the resistance of the water. In case, the body is not pointed at the front and it is blunt, the water current and flow would resist the movement of the organism further. So, for the locomotion purpose, it is important to have a streamlined body. Further smooth and hair less body also decrease the resistance during the movement in the water.

7 0
2 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
How is DNA changed to make a Genetically Modified organism.
strojnjashka [21]

Answer:

GM is a technology that involves inserting DNA into the genome of an organism. To produce a GM plant, new DNA is transferred into plant cells. Usually, the cells are then grown in tissue culture where they develop into plants. The seeds produced by these plants will inherit the new DNA.

Explanation:

6 0
2 years ago
Fase del ciclo celular en el que las células crecen, duplican orgánulos y sintetizan ADN
m_a_m_a [10]

Answer:

Phase of the cell cycle in which cells grow, duplicate organelles, and synthesize DNA.

S phase

Explanation:

 DNA replication occurs in synthesis or in the S phase of the cell cycle. Each chromosome is copied with high fidelity in a process that involves a large number of enzymes. In this process the double strand of DNA breaks down and each individual strand is used as a template for the production of the complementary one. The result is the production of two identical copies of the genetic material.

7 0
3 years ago
Other questions:
  • The elements of the Earth undergo chemical reactions that build molecules, destroy molecules, and change molecules into other mo
    9·1 answer
  • Now can you predict nucleotide quantities in a hypothetical scenario with more than four different types of nucleotides? An alie
    11·1 answer
  • A cross is performed between a plant with genotype TtYy and a plant with genotype Ttyy. If the two genes independently assort, w
    14·2 answers
  • You observe a high proportion of malarial infections in a small village located in Angola. Malaria is caused by the protozoan Pl
    13·1 answer
  • Is HIV virus living or non living
    15·1 answer
  • In order to get a daughter cell what two things must happen?
    10·1 answer
  • NEED ASAP! Lividity in a dead body is caused by capillaries decaying due to de-oxygenation
    15·1 answer
  • The car is blue. What does that tell you about the light interacting with it?
    5·2 answers
  • CAN SOMEONE PLEASE HELP ME WITH THIS SCIENCE QUESTION I WILL MARK YOU BRAINLIEST THANK YOU !!!
    11·1 answer
  • Why are there holes in the ends of phloem tubes?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!