1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Musya8 [376]
2 years ago
9

What happens to macromolecules from food during digestion?

Biology
1 answer:
Greeley [361]2 years ago
8 0

Answer:

In chemical digestion, enzymes break down food into the small molecules the body can use. It is important to break down macromolecules into smaller fragments that are of suitable size for absorption across cell membranes.

Amino acids are the monomers that makes up protein

If it's in the table, it's an element! Atoms can join together - they form bonds together - to make MOLECULES. For example, two atoms of hydrogen hook together to form a molecule of hydrogen, H2 for short.

BONDING. When atoms join together to form molecules, they are held together by chemical bonds. These bonds form as a result of the sharing or exchange of electrons between the atoms. ... Different atoms use these electrons to form one of three different types of bond: ionic bonds, covalent bonds, or metallic bonds.

Proteins. ...

Lipids. ...

Carbohydrates. ...

Nucleic Acids.

Respiration, which consists of three phases, occurs in the mitochondria, the cell's “powerhouses.” This metabolic pathway traps the maximum amount of stored chemical energy within a molecule of glucose, generating a total of 30 molecules of ATP in conjunction with glycolysis.

Please give me a brainliest...Thank you

You might be interested in
Which of the following animals indicated in the Antarctica Food Web folder utilizes the Crabeater Seal as a source of food? a. H
solong [7]

Answer:

Krill

Explanation:

Based on the information provided within the question it can be said that the the Crabeater Seal's main source of food are Krill. These are a type of shrimp that can be found in cold water such as Antarctica. Despite the misleading name Crabeater Seal' do not eat crabs seeing as since the are no crabs in Antartica.

4 0
3 years ago
What process is responsible for or leads to magma that is intermediate and often variable in chemistry, when erupted in the casc
ozzi
Intermediate magma is also known as andesitic magmas and these are created when an oceanic plate subducts beneath a continental plate. The magma is generated in the wedge of mantle rock beneath the crust. The Cascade Mountain Range is formed due to the subduction of the Juan de Fuca Plate beneath the North American Plate. 
8 0
3 years ago
What structures work in antagonistic pairs to move bones?
Olegator [25]

Answer

Option C - Skeletal Muscles

Explanation

Antagonistic pairs are the muscles that are functionally opposite, if one produces flexion, then the other's primary action is an extension. Skeletal muscles work in pairs to move a bone so that the muscles can function properly. They contract the bone making nerves deliver a message to the brain. For example. Biceps and triceps. The lower arm is moved upwards when the biceps muscle contracts and the triceps muscle is relaxed and vice versa.

4 0
3 years ago
Read 2 more answers
Which of the following is a secondary color?<br> A. blue <br> B. orange <br> C. red <br> D. yellow
Grace [21]
Orange i hope this helps you
4 0
3 years ago
Cystic fibrosis is an autosomal recessive disease. if parents, both suffering from cystic fibrosis, have children, what is the p
Lerok [7]
B . its a 50 50 chance because the traits are stronger 
4 0
3 years ago
Read 2 more answers
Other questions:
  • WILL GIVE BRAINLIEST!!!!!!!!!!
    10·2 answers
  • A structural adaptation enabling an organism to blend in with its environment is ____________________.
    9·2 answers
  • Really need help plz
    7·1 answer
  • Explain the difference between abiotic factors that may be found in a desert compared to a temperate forest
    10·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Why is it not totally surprising that animals can suffer from emotional distress or mental illness?
    7·1 answer
  • Homologous recombination occurs in a heterozygote in which alleles D and d differ by a single base pair. The D allele has a G (a
    15·1 answer
  • The genome is _______ the genome size.<br><br> A. larger than<br> B. smaller than<br> C. equal to
    7·2 answers
  • Which solution is more concentrated?
    9·1 answer
  • A person living in a coma is considered living or dead?​
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!