Answer:
A. Carbon dioxide travels from the heart to the lungs in pulmonary arteries
Explanation:
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
<span>Lactic acids are provided to help the body go without oxygen for a time period</span>
Its called osmosis and it only happens with water. now I'm just adding words to be able to post this. its moving down the concentration gradient.