1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vitek1552 [10]
3 years ago
11

A fruit fly mutant, clop eye (one eye in

Biology
1 answer:
timofeeve [1]3 years ago
3 0

Answer:

is this a question?

Explanation:

You might be interested in
I need help in this asap
madreJ [45]

Answer:

a

Explanation:

5 0
3 years ago
The gd mat on the fur of the bats should be expected to consist of _____.
Alex Ar [27]
The Gd mat on the fur of the bats should be expected to consist of Hyphae. 
Although WNS is a disease of hibernating bats, severe wing damage due to fungal hyphae may be seen in bats that have recently emerged from hibernation. These recently emerged bats also have a robust suppurative inflammatory response.
8 0
4 years ago
Marine organisms are classified according to how they what?
Mekhanik [1.2K]
"Their habitats may range from the surface water to the ocean trenches. Marine organisms are classified<span> by how they move and where they live."

Hope This somehow helps~
</span>
6 0
3 years ago
What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer
Fittoniya [83]
I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC
8 0
4 years ago
What are the two groups called that make up the naming system?
Olegator [25]
I think what your looking for is Genus and species
5 0
4 years ago
Other questions:
  • What state best describes natural selection
    14·1 answer
  • What is the phenotypic ratio of a monohybrid cross between two heterozygous parents?
    13·1 answer
  • The mass number of iodine is 126, and it’s in the 53rd place in the periodic table. It has ___ protons and ___ neutrons
    9·2 answers
  • Michael is extremely fearful of germs. He thinks about them constantly, wears gloves and a facemask when he's out in public and
    12·1 answer
  • What is a dihybrid cross?
    15·2 answers
  • The venom of the Eastern diamondback rattler and the Indian cobra contains phospholipase A2, which catalyzes the hydrolysis of f
    13·1 answer
  • In order to fit all of our DNA into our cells, it is wrapped around histone proteins and then __________.
    11·1 answer
  • Can either a genotype or phenotype be expressed as a percentage?​
    5·1 answer
  • Which crossbreeding system produces replacement females through the rotation and produces crossbred offspring?
    13·1 answer
  • For a species with a Type II curve, less than ____% of individuals survive for 50% of the maximum life span. At 50% of maximum l
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!