1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kazeer [188]
3 years ago
11

An agricultural biologist was evaluating two newly developed varieties of wheat as potential crops. In an experiment, seedlings

were germinated on moist paper towels at 20ºC for 48 hours. Oxygen consumption of the two-day-old seedlings was measured at different temperatures. The data are shown in the graph below. In a second experiment, variety A seedlings at both temperatures were treated with a chemical that prevents NADH from being oxidized to NAD+. Predict the most likely effect of the chemical on metabolism and oxygen consumption of the treated seedlings. Explain your prediction.
Biology
1 answer:
Rus_ich [418]3 years ago
8 0

Answer:

The definition is listed in the clarification segment below, and according to the present circumstances.

Explanation:

It undergoes different morphological as well as biochemical modifications mostly during germination. Product contains nutrients and even some hydrolases such as energy, carbohydrates. Owing to the availability of phytic compounds, the seed coat seems to be very durable in nature. Hydrolytic enzymes launch their function by consuming oxygen throughout order to remove this hard coating. In several other processes, including the electron transport system as well as the Kreb process, oxygen also becomes necessary.

  • The initial phase of germinating seeds requires anaerobic environments where even the enzymes dehydrogenase can function. The subsequent dehydrogenase enzyme brings the electron throughout the electron transport system from either the base to oxygen.  
  • Unless the oxygen frequency is compared with varieties A and B, it can be seen through the analysis that variety B actually absorbed more oxygen. Oxygen intake rates are also depending upon period.
  • The impact of temperature mostly on absorption of oxygen seems to be present. Shift the supply at low temperatures have a low intake of oxygen, while varieties grown over extreme temperatures use much more oxygen. The metabolism of such a seedling is influenced by temperature. Metabolically active young plants display a larger intake of oxygen.
You might be interested in
Which change is an example of a response to a stimulis?
Nastasia [14]
When the plant change its direction towards sunlight
3 0
3 years ago
What is the relationship between the health of the environment and human health​
ASHA 777 [7]

Answer:

<h3>★★Human health is influenced by many factors like nutritional, biological, chemical or psychological. It is quite true that environment has a direct impact on those living in it and many diseases are the outcome of man's maladjustment to his environment.</h3>
5 0
3 years ago
Read 2 more answers
What type of asteroid/meteorite do they believe brought some water to the Earth?
sergij07 [2.7K]
The answer should be d
3 0
3 years ago
How do particles move in solids, liquids, and gases.
zhenek [66]

Answer:

particles move fastest and with the highest kinetic energy in a gas, and slowest with the lowest kinetic energy in a solid. particles in a liquid are between the 2

8 0
3 years ago
Read 2 more answers
In guinea pigs, dark hair (D) is dominant over light hair (d) and curly hair (C) is dominant over smooth hair (c). Complete a di
Alexxx [7]
P:               DdCc          x           DdCc
g:      DC  Dc  dC  dc           DC  Dc  dC  dc

1.)
 
              DC                       Dc                   dC                     dc

DC       DDCC                   DDCc              DdCC              DdCc
Dc        DDCc                    DDcc              DdCc               Ddcc
dC        DdCC                   DdCc               ddCC              ddCc
dc         DdCc                    Ddcc               ddCc               ddcc 

2.)

G= 1:2:2:1:1:4:2:2:1

3.)

F= 9:3:3:1
7 0
3 years ago
Other questions:
  • Which organ system is responsible for transporting oxygen throughout the human body?
    14·2 answers
  • Primary succession begins after a
    10·1 answer
  • In active transport, this is a cell transport (biology) question, what are the two main characteristics?
    7·1 answer
  • Which of the following is the earliest step in transcription? A. RNA polymerase encounters a termination signal, and the DNA mol
    6·2 answers
  • Define the term postpurchase cognitive dissonance and give an example of when this happened to you. Then explain what the compan
    13·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • 11. What did Darwin think about on his journey home to England?
    10·1 answer
  • If water molecules changed into a new kind of molecule during a phase change, would water still be water?
    6·1 answer
  • What is threatened by an increase in fungal diseases? Check all that apply.
    12·2 answers
  • Herceptin,a drug developed by the biotechnology industry, is used to treat breast cancer. it is taken only after a patient under
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!